Description :
From Genome Similarity Track
Location :
Scaffold_22:109726- 111243
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06419Hypothetical protein

Sequence
1517 bases(100 bases per row)
TGCTGCACTGTCGGGAGCGCCAGAACGGTGAGCGATGTCGCACAAGTGGATGAACGATGCCGAGAATCTGGCGCTGTGCCATGCGTGGATAGCTGCCTCC
GAGGACCCGATCAAAGGCTCTGGGCTCAAGTACAACACGTTTTGGCAAAACGTCACCGAGCAATACAACGAGCTCAAGCCAAAGGATCGGCCGGAGCGAT
CATTTCGCTCGCTCGAGTCCAAGTTCTCGCAGATTCGACACGATGCATTGAAGTTTGGCAGCTACTACGCGCAGGTTCTCCATCTTGATCGGATTCGAAT
GTAGTTTACCGTATGTACTAGATTGTAGATTTGCAATCCACAGGCACGAACGTCGACGACACGGTAGAGGCTGCCCAACGCCTGTATACCGCACACGCCG
AGAAAGAAGGATCCAAGGGCAAGAAATCTCAATTTCAATTCCTCGAGTGTTGGCGCTACCTGAAGGACTGTCCGAAGTGGCAAACTGTCATGGGGGAAGT
GCGGGTCTCAGAGATCGTCAAGCAAAAGCCCCGCCGCGAGCTGGAGGAGCCCGACGTGCCTCTTCCCATGGTCAAGAAGGCCAAGACGACGACGCCAACG
CTCGATCGACCCATTGACGTCAAGGCGGCGAAGCGGTTGGCGCGCTTGGAACACGCAACCAAGTGCAAGGACGATGCAATCGAGGTCGCGGCGAAGGCGC
TCGCAGATGCAGTAGCAATCAGAGCCGAGGCGCAGATGATCATGGCACACACGCAGGTGTTTCGTGTCGACATCACCACGCTTGACGACGAATGCCGTCG
GTACTTCCAGCTGCAGCGGCGCGCGATTCTTGCCGACCTCGAAAAGCGTGCAAAGGCCCGAGAAGAGGAAGCTGCGGCGGCCGCTACTAGTACCAGTACA
CGGAAAAGGCGCACATGTCGCTCACTACGGAAGGCAGCGAGGACGACGAAGTCGAAGCGGTCGTCGAAGAGGACGATGGCGACCAGGACGTTGACGTCGG
AGATCAAGACAGCACGACGGAGGCACCCTCACGCGCAACAAGCACATCGTTACTTGCACTTGGGTTCTATGGCGACAGCGACAGCGATGGCAACATTGCA
GTTTAATGCATAAATGAGACTGCAAGTTGCACATGTACTACATGAATTACTTGTTGCCTTTCAGCTTACACTGGTGCTCGACCATTGCAGACCGTAGCTC
CTCATGTGTGTGCCTTTGCATCAGTCACTGCCGTCGAGCGCACGATATACTCGTCGACGGAGAGCTTCGGTCGCGCGCCATAGCGGATGATCGCACTGGA
CGATGGAAGTGTAGCTTCGGCATCCGCCTCGTTCGCTTCGTCATGTTGTGACGTCAGATGCATGCCTTCTAAATCTTGGTCATTGCTGCTGGAGACCACG
AGCGGCTCGGGTTCGCAAAAAATGTGGAAGCGTCTGAAAGGGACTTCGACGCAACGCTCAACGTCTTTCCGTACTGCTTTATGCTTCTGCTTGAAATCAC
GCACCTTCGACTCGACG