Description :
From Genome Similarity Track
Location :
Scaffold_424:10970- 13288
Transcript NameFunction/comments
Phymu_g9767proline synthetase co-transcribed bacterial protein
Phymu_g9768hypothetical protein

Sequence
2318 bases(100 bases per row)
TGTATTTGCATATTGGTATGTATCACACGGACTTGCACTAACAAGATGAAAGCTACAGTCTGTAGCCTACAGATCCTAAATTCCTGAGTGTAGTTAAAAA
TTCTGAGAGCTGTCTGCCGATAGAGATGAACTTtgccacgaagaagcactACCATCCGTCGACTCGTCCTGTGAACCTGAAGCGGACTCGAAGAGCCAAT
TTTCCACAGAAGAATCCGACAAATCTGAAGAATCCGAGGAATCTGAACCCGAGACCAAAGCGCTCTCTTCACTATCCGCCGATGTGCTCTCGGAATCGAA
CGCTGAATCCTCGAAGGACCCGGATTGCGAGTCAACCCAGTTACCAAGCGAACTAGTTAGAGAGTCATCAAGTAATGAGTTGGATGCGCTGTAGCTCGAT
CCGCTGCCCCATTCTTTCCCTTCAGAAATTGACGAGCCAGCACTCGAACCGCTTGAACTGTCATTCGTTTCATCACTGGTCGTTGGTCCATCGTCGGAGC
CATCAAGCCACGACGACTCCCTCCCCACGCTACCAGTCCCAACATTGCTTGACCCGCCAATGATCGACACTCCTCCCCCTGTGCTATCCGCGCTGGTGGT
CTCCGCAGTGGTAGTGTCGCTTGTGCTTTTTAGAGTCGCAATGGCAATGACTCCGAAGACCGCACCACATACCATGAGGAGCGCGATCGCTCCACGTGTG
CTCCACGGACGTGTCATCGGGACTGGAACTGACCGTAAAACTGGATACCGCGTCAGCGCTCCACCTTCCATTTCCTCGAGGCGATCGAAGCCACTCGAGT
GGTACAGCAGGTTGTTGCTTTCTGTCATCATTTTTGCTTTGCAGACGTCGCTTGTTTAAGCTGACAAAAGATTATGCGTGTGAGGGACAGCAGTCGATTG
GAAAACTGGACCAACGTCTCCAAATCCGCCAAGGTCAAGTCCGTTGAGCTGCGATCGCTCCGTCAATATTTCTCTTCACGGCATCCCACACAACCTAAAA
TAGGCAAAGGACATCActttcagcagcatcgccagctcTACACAACTGACCATCATTATACATATACATTTCCCAACTCTACATCAAGGAAGAAACTACC
ATGAGATCGTTCAACTTGTCTATGATGTGAACCACCTCACATAACTTACAATGCGTACACAAATTATGTGTACCTAGCCTGAATCGGTGACGTATTTCTC
GACCACTACTCTGCGCAATGCTGCGCCAATTCCTAGCTGCACGCGGCGGCTTGGGGCGTCGCTCGCAGGCCGCCCTAGGCGGTAAATCAAGTGTTATCAG
ATGCGCTGGGACATCTTCTACGACATCACCGCGCGCTCATGCCCAAATCAATATGTATAACGCACGTCAATGGATCGAAAAAATCGCTCCGAGTCTGCAG
ACTTTTTTGGCTTTAGAGAAGCACCTGCTCGTCCCAAACAAGTTCATAGTACCGTATGGAGACACAGCATGGCCGGAGAAGACCTGGGGTTACCCGTTGG
GTTTGTACTGCAAGAACCTGCGCTCGCTCCGTCACCAAGGCAAGAATCTCCCGTTCTTCGCCATAGAAGACCTGGAAGCCATCAACTTCCCGTGGGATAT
GCGGCAACACAAATTCGACGTCCTCGTGCTGCCTGGGCTCAAGACATATTTCCAGATCAACGAGCACTGCGACATGCCCACCTCGTTCGTGGTTCCTGTG
GGGGATGAAGCCTGGCCGAAGGTACTGTGGGGTTTTAAACTCGGACAGACTGTCATGGGAATGAGGTATGGCGACTCGTACAGAGTCCAACGGGAGCGCG
CTGCtgacgagctggagaagattggCTATACCACGCAGTCCTGGAAGGCCCGTCAGTGGGAGACGAAGATCTTACCCGCCTTAGAGACTTTTGAGCGCGA
GTTCAAGCACTGCAACGTGAATTTCAACTTTGTCGTGCCGAGGAACAACAAGTGGCCAAAGGCGGCAAGGGGAATTAGACTGGGAGCGATCGTCGCCAAT
ATGCGTTGCAGAAAGAACTACGTTGACTTGGCAGAGCGAGACAAGGACAAGTTGGAGGCACTTGGCTTCATTTGGTCCCCGGACGAGCACAAATGGACCG
ACGTGATCATGCCGGCTCTCGAGACGTATAACGCGCTATACGGGACAGGATGGATTCCGGTTGGTTTCGTTGTCCCGGATGAAGCGCCTTGGCCAGAATC
AACTCGCGGACTTCGACTTGGAAACATTTTCATGAAAATCCGGCACACAGGCGCATACTCCACATTTGTGGAGAGGGATAGAGAGCATCTGGATGCAATC
GGCTTCGACTTTAACGTG