Description :
From Genome Similarity Track
Location :
Scaffold_720:1097- 2514
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_720-snap-gene-0.8Threonine synthase
Pytiw_DAOMBR242034maker-piw_contig_720-fgenesh-gene-0.0Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_720-fgenesh-gene-0.4HCG1784313, (LOC100000931), mRNA

Sequence
1417 bases(100 bases per row)
ATCTTGACCACGGGCGTCGTCTCCTTGTCGCGGAACGTCTGCGCGTTGTAGCTCTTGCGCACGAGCGCCGCGAGCTCCGTGGTCGAGATCTCCTTCTCGT
CGATGAAAAGTCGCATGACGCGCACCGCGAGCTCCTGGTACGACAGCTTAGCCCAGTCCTGCAGCGCATTGGGCGGTAGCTGCGGGAACTGGCCGGCCTC
AGGCACGAGCAGGCCGCGGTCCGACGCGAGGCCCGTGAGCACGGCCTGCTCGAACGTGAGGTTGCGCATGCCGCCGCGGGTGCTGCGGTAGTGCACCATG
GTCGTCGGATGGAGAAGGAGGAGGATGCTTGGGGCTCGTCCGCTGGGCTTGGATTGCAAAGTGAGCTCTTCGCTTTTGGGCTGTTGCGTTATGCGCGTCA
CATTTTTGGCCGTTGGAGCGACCTTCGCGCAACCTGCGAAACGGATCTTGCGTTCGAGCGACATTTTGCACCGTTTCTCTGGGCCAGAAGAACGTTCTGT
GTTGCTCACAATAGTGGCCGCTCATGACGCAAACACCACCCGGTTCTGTGACAAAACCGGGGGCGAAACAGTGCGAGGTAGACTTGTCTGCAGCATTATG
CTGTTTACTAGGATTTCGATGGGATGGCTACACTTTGAGAGTGTAGCCATACATACTATCGAGTGAGTGTTTGACTTCGGCAGAGCTGCAAGCTCAGAGG
CGCTATCTCTTGGCTGACGGAGGGTTCGACAAAGTCATACTTGCGCATTGCCTGTTCCGCACTTGCTTGTTGACTTGTGAATGTTGCTGGATTCTGGACG
TCGTCCGAGATCGCCGCCATCCTCGACCTGCGCTCGGAGCAGTTTGCTAATCGCCACTGGAACATCGTCTCATGCAGCGCGTTCGCGGGCGACGGCCTCA
TCACGGGCATCGACTGGTTCATGTGCGACATTGCGAGTCGAATCTTCCTCATGGAGTAGTACTTGTTGCAACAACACCCACATTTATAAACATTTCGCGT
TTCATTTAGGTTCGTGAACTAGGATTCCGACGGTATAGCTGCATCTGGATCTGCTGAAGCTTCGATCTCGGCGTTCACGTCGCGATAGACCAAGGCTGCA
GGCTCATGAGCGCTCTCTCTAGGCTCATCGCTCGGCTCATCAGCTTGCTCGTGGGCCTCAATGCTTAACTTGTCAGCTTGCCGGGCATCCTCCTCCTGCT
TGTCAGCAGCTATTACAGCTGAACTCTGGGCAACCGACTCCTCTTCTGAGCCAAGCACCTCGACGTAGTTCGCTGGGAAGATGCCGCAAGTCCCATCGCA
GCGCTCTCCTGCCCACCATTCGTCGCTCTCCTGAGAGAGCACGCGCAGGATCTCTCCACTGTGAAAAGTGAGCTCATCAGGGCTCTCAGCAGTGAAGTCG
TGTCTAGCACGCGCTTG