Description :
From Genome Similarity Track
Location :
Scaffold_9:1096348- 1099298
Sequence
2950 bases(100 bases per row)
GGCTCAGCGCCTTATGGCCAAGCTCGTCAGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGC
GCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACACTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTC
GGTGTATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGG
GGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAACAAGAAGAAGAAGCACGCGTCTG
TGCAGGTCACAGACGTCGACAAGAGCAACAACAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGACCTACTGC
TAGAAACGAGCTGAACGAGTTCAGCTCGGACTCAATCAACTTCGTGCAGCGCAGACAAGCCATCATTCGGTTTGGCCAAGACGCTATCGCAGCTTCTGTC
GGTCGACAGAAGCTGAACGCAGACAATGTTGGTAAGGGCAACACTAATGAATTCAAGAAGGGTACATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAAC
ATTCCGTTTCCGACGTCGGGGCGAGCAAGCTCGCTCCGTGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACACCTACACGCTAGATATTCC
ATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAACCACCTAGCTCGTCTGGCCCGAAGCGGAAGCCCCAG
CGGGAGTGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTG
AGCGACTTGAGCCCTCAGGAACGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGG
CCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCAGCTCAACACGCTGGATTGTTGAGCGT
ATTGTGAACCATAGTACCCCGAAAACGAACCGTCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGG
ACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCG
CCCGAGATCCCACGATCGTCGCGTTCCTCGCGTGCCAGGAATTTGGTACGAAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGT
CGCGGTCGCTCAAGCGCACCGCACCTGGAAGACACAACGTGCACTGATGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAG
CTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGGGCGTACTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACA
AAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGTGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGTTCGTGAAATAGTCCGA
TATAGTAATCGCGCCTTTGATTCGTTAACGGATCAAATTGCTGCTCCTCCGCCACAGCATCATCGTGGATCCCGCTGCATACGTACAGCGGAATTTCATT
TGGAGGCACGGTGTTGCCCACACGGTCTGCGATCTCTGACGCAAACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAACTTGAAGACGCC
ACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAGAGCGGAGTTTCGCTCTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCAC
GAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCACTGTCGATAGACTCCTTGCGCTTGTTGGAAGAGGCCTCGCCCTCTTCCATCTCTACGTCGTC
ACTCCCATAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGACTGAGTTGTCCCCAACGCGGCCTTTGCAGCGAGCGCGTCGCAC
TTTGCCTGCTGGCGCTCATGGTACTGAGCAACAGAGGTTACCATCTGTTCCGGCGGCGGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTT
TTCTTTCTGCCAACGTGAAGAATTGACGAATGGTCAATGTCCTGATTGACGTGCCGTCACTCGGCGCGTCTAACCTTGAGGGGGGTTGGTGTAGCAGGGT
TACACGCACAAGTGGCTACAGTCACTTGTAACTCTAGCAGACATGACGTCTGTTAGAAGTTCGAAAGACTTTCTCGACTTTGGTGTAGACACACCAAAGG
CTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGTTGAGAGCAGCGTCTTTTAGCCAATGAGTGACATGCATAGC
ATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTA
ACCCAAAAACATTATTTGGTTCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAAATAACTCTATTTTAAACTAGGCTACGCTTCCTCACATA
CACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACA