Description :
From Genome Similarity Track
Location :
Scaffold_13:1096193- 1099328
Sequence
3135 bases(100 bases per row)
GCGTGAGCTCTCGATGCTCGACCGCACCATCGACTGGCGAGAGCCCCTGCTCGATCGCCGTCGTAGCCGGTGGGAGTGCTCGACCACCGCTGTGGATGAC
GGGAGCTCCAACTGCTCGACCGCCGAATCGCGTTGCGGGTACCTCTGCTCAACCGCTAGAGTGATTTGCGAGAACCCATGCTCAACTGCCTTGGTGTGTT
GCGGGAACCCATGCTCGACCGCCGTGTTGCGTGACGGGAACCCATGCTCGACCGCCGTGTTGCGTGACGGGAACCCATGCTCGACCACCGTGTCGTGTGA
CGGGAACTTATGCTCGACCGCCTGCTCGGATTGCGGGAGCCCCTGCTCTACCGCCAAAGTGCTAACAACCTCGCTTCGCAGCGAGGAGTTTTCGTGCAAC
AGCGCTGTGCAAGACATACAGAGAGGACCATCGCTCGCTCTCTGCTCAACCTGCATTGTGGACAACCGGTCCACGCCCGTGACATGGGGCCAGTCTTTCT
GGGCAACCAGGAGGTGCGTGAACACCTCACTCACATCGAAACCAGAGCGGTGTTTAACCGACCGAGCCAACCAGTCAATCTCTGGTTGATATCGCGACAA
CCACGGGATACCCAAGATGCAGTCGAACGCGTAGTTCATCTCAATCACGAGGAAGTCGTCGTTGCTGCGGAAACCGTCGAATATGTACGGCAACGTGATC
TCGCGCCGCGCAACGCGGCGTGGCTTTTCGTCAGCAAGTTTGACGATGACCTGACCTCGACCATTACGGACTGCGATCTCTCTTGGAAGCATGGATAAGC
AAGATTCGCGAAAGAAGTTATTCGACGCTCCTGAGTCCAGGAGTGCGCGAAGTGGTCGCCGGGCGCTGGCGACATGAAGACTGACGATGATCAGCCTCGG
GTCGCCCGACGTGGTGGTGGCATTAAAGTGTGCGTGGAGCACAGGAGGGCTAGAAGATTGGGTAGCCACCGGGGGACCCGGACCTCCATTCCAGCCAGTA
GGGTGCCCCGCACCTACTGGCCCTGACCGTTTTTTGACTGAACGGCAGGTGAGACTTCGGCGGTGTGCGCGAGTACCGGCGCTGGCGCGCGGCATCCCGC
CGCGCGATGACCGATCTTCCGGCAGCGGAAGCAAGTGAGCGGGCGATTAGGACGGCCGTTGGGCCCACAAGTCGACTGACGGTGACTATTCGACGCGTCA
ATCGCGTCGATCTCCATGGGCTCGGGGGCTGACGCACGAGCTGCCGTAGACATCGCGCATGCGTAAGACGCCGCCACAACATAGGCTTCGCGTAATGCGA
GGGCGAATGCTTCCTCGAGCGAGGAAGGTTCCGCTCGGGTCAGGCAGTACCGTGTCATGCCTTCACGCATGCCGAATACGAGTACATGAACCTGCGATGC
TGTGTCAATCGGATTTGTCACGATGCATGACGCGAGGCGGCGAGTCTTTTGAACGTAGTCGCGCATAGTCATTTTACCTTGGCGAAGGGCGAAGAACTCG
GCACGCACGCGGGACTCGTCTTGAGGCGGATCGATCGCGAGCCTGAGATCTTTCTGGAGAGACTCCAGAGTGGGGAATGCGTCGTGATCAACAACAAGTT
TACCGAGGGCCCATTCCTTGGCCTTCCCGGACAGCCGGGACAATAAGAAATTGACCTTTGTCCCTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTC
GATCTCGCGAAACCACCGGTTCAGCGGGAGGCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTCCAGCTTCACGACATCATTTTTCGAGGAACGCGCG
GGAGTTGTTGCTCGCCGATTTGCATCGGCTAGCTCACGTTCCATGAACGCTTGGGCTGCTTGGTCGGACGTCGCTGAGCTCAGCAGCGACGCGATTATAG
CCTCACCAGACACCGCCGCGAGGCGGTGAAGGGCTTTCCACTCGACACGAGTGAGATGAGGGAAAGCAGCATGTTCTAGGGTCGGCCCTGGCGTTTCAGA
CGTCATACCTTGGCTCATCGTGAACTTGGTCATGGGAAGGACTACAAAGAGCTACCAGGTGTAACGGGCCTGGGGAGTCCGTTACTTGCTTACACGTAGT
GATGAGGAAGCGTACAAGTCCAGTGATACTGAAACCAAGTACTTAGCCTGAAGGAAAATCAACTCTGTTTTTATTTAGGTCCAGGGCGGCTTGCCCTGAC
CACTCAAATACACGTCAACTCCTTATTGGTTGATTATGGGTCTGGTTCCCCATATTTCAACTAATAGGGTGACGGCAGTTCAGCAATCGCTACTCGTGTG
CTGCTGCACCTACTTTTGTAATGCAAATCTACCTACTTATGTAATGGTGTGAGCCACTACAAAGAACCTATAAAACTACCTACGTATGTAACTTGGGAGG
GCCCATTGCAGATGGTGGCAGCGCCCAGAGTAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACATAGTTCCGCAGACAGCTGCAGCTGT
CACGAACACTGACAACAGCGTGTTCAGAGTGTGCAACAGAGTTCCACACACGGTTGGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTG
TGTAGATAACAAAGCTCCACACACGGTCGACAAGTTCTTAACTGAAAAGGAAGACGTCGGATACGCTTCCTGTGTGGGTACCACAGTAGCAGACGAGGCC
ACGAGTGCCTCGGATGTCGGCACTCCTACATCCCCAGACGTGGTTAACAGAGCTCCACGTCACGGTCGCCGTCGACGACGACGCCGCCGCCGCCACAAGT
CGGGTCTGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGGCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTT
CGATGGCGAGACCGGTTTACCCGTCAAGTCATCTGGTGTCCACTTGGAGTCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAG
TCTTTCCTGGCAACCTCAAGGCTGGAAAGGTTGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTAAACTCCTCCTCTGTCTTGGACGA
GAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGG