Description :
From Genome Similarity Track
Location :
Scaffold_304:10959- 13175
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_304-snap-gene-0.15Myosin

Sequence
2216 bases(100 bases per row)
CGTGCTGCTGCAGAACGCGGCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGCTGCCGCACCTGCACGAGGCGTCCATC
CTGCACGCGCTGCGGCTGCGGTACGCGCGCCACGCCATCTACACGCACATCGGCGAGATCCTGCTGTCGGTGAACCCGTTCGAGCCGCTCCCGGAGCTGT
ACGCGTGGCCGCAGATGTGCGAGTTCGCGCCGGACGCGGCCGTCGGCAACAACGAGCCGCACCTGTTCGGCGTCGCCCGCGCCGCGTACGTGGATGTCGT
TCGGAACGCGCGCAACCAGTCGATCCTGATCAGCGGCGAGAGCGGCGCTGGCAAGACCGAGGCCACCAAGATCCTCATGAAGTACTTTGCGCTCACGTGC
GGCCAGGGCGTGGGCGGGTCCAAGCCTTCGTCGCCTACCACGAAGGGCCCTCCGTCCACGACCAAGACGTCGCTCGAGGCGCGCGTGCTGCAATCGAACC
CGATCCTCGAGTCGTTCGGCAACGCGCGCACCGTGCGCAACGACAACAGTAGTCGCTTCGGAAAGTTCATCGAGCTCCAGCTGGACCCGCGGCGCCACCA
CGCACTGCGCGGCGCGCGCGTCCGCACGTACCTGCTCGAGAAGATCCGCGTGATCCGGCAGGCAGCGGGCGAGCGCAACTTCCACGTCTTTTACGAGCTG
CTCGCTGCAGCGGACGCCTCGGTTGATTCCACCGAGGACACGCACAGCCTGCACCAAGACCACTCGGAGCTGAGCGTCGCTGACCAGAACGCAGATGCCA
CTGACCGCGCGCTCTTCCGGCTCGCAGCCGATCACCGAGACGACTGGGGGCTCCGCTCGCCGCTCGACTTTGCGTTGCTCAACCAGAGCGGCTGCTTTGA
GCGCCGCGATGGCGTGCAGGACGCCGTTCAATTCCGCCGCACGCTGCGCGGCATGACGCGACTTGGTCTGGCTCAAAGCGAGATCCGCAGCGTGCTCGAG
ATCATCGCTGCTGTGTTGCACATGGGCAACGTGAAGTTCGCCGAAACACAGCGAGACAATGTGCGCGCGGCTGTGGTGGTGGACAACGTTGCTGACGACC
CGTTCGAGTCGTTCCGCCGCTCGGCCGAGCTGTTGGGCGTGGCACAAGGTCCGTTGGCAGCCGCGCTCACTCGTCGAACTCTGCACACCGCGGCAGAGAC
ACTCGAGGTGGCACTCGACGCCACGCGCGCGGCCAACACTCGCGACGCGCTCGCAATGGAGTGCTACCGCCTGCTGTTCGACTGGCTCGTGGGCCGTGTC
AACGCTCGACTTCAGCCGGTAGGGATGTCGGGCGAGTCGGCGTTCATCGGGCTGCTCGACATCTTCGGGTTCGAGGACATGGCGGTCAACTCGTTTGAGC
AACTCTGCATCAACTACGCGAACGAGGCGCTACAGCACCAGTTCAACGAGTCCGTGTTCGACCACGAGCAGCAGCTGTACGCAGACGAAGGCATCAAGTG
GGCGTTCGTCGACTTCCCGAACAACGCCGCGTGCCTCGCGCTGTTCGAGAAGAAGCCCGTGGGACTCTTCTCGCTTGCTGACCAAGAGTGCGTCTTTCCG
ACTGGCTCGGACCGCGCGCTCTGCACCAAGCTCTACCTCGAGTTCGACAAGAAGCAGCCTCATTTCGTGGCGGCAACAGCCCTCAAGCGCCAGACGCACT
TTGGCATTGCGCACTATGCCGGGACGGTGCTCTATGACGTCGCCGATTTCCTCGTCAAGAACAAGGACGCCTTCGGTGAAAGTGCGGCGCGATTGCTCGC
GCAGTCGACCAACCCGCTCATTCAGTCGCTCGCCGTTGCCGCCGCTTCGCCTGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCTGAGTGGCG
GTGCAGATGACGAGGACGACTCTGAGACATGGCCTCGACCACGCCGCGCGTCCACTTCATCGCCAGCACCTCGCGTGGCGATCCGCCGCGCACACTCGAG
CATCGCTGCCACAAGTGTCGGCTCCCAGTTCAAGTTGCAGCTCGGCGAGCTGCTGACGATGATTCGCTGTACGGCCCCGCGCTACGTCCGGTGCATCAAG
CCTAACGACCGGAACCAAAGCGGCACCTTCGACGCTCGCCGCGTTGTTGAGCAACTGCGCAGTGGTGGTGTGCTGGAGGCGGTGCGCGTCGCTCGCGCAG
GGTTCCCCGTCCGCCT