Description :
From Genome Similarity Track
Location :
Scaffold_8:109583- 112542
Sequence
2959 bases(100 bases per row)
CGGTCTAAAGGGGTAGTCATAATCTGTTCCCAGCCATCTGCTATTTCTTCAGCAAGTTGCTGTGACCGATTCGACCCGTACGTAGCTTGCTACCCAGGCG
CATGATAATGTTGTCCTAAAATTTAGTCGCAATTCGGGCGTAGAAGCGTCATGATGTCTCGCCCGGAGCTTAAGTGTGCTGCACAAACAGTCGCTCCTTC
TTGGTACTCAGCTATAAAGGAAGACACTCCGAGACATTTTTACGAAGTTCCTCCTTATTAACGACGAGGCTAGGGTGATTGCATCCCGTTTGGGCACTCA
CCGGAGAATCATCAGATGAACGCGCCTCCAAGAGCGCTGCACCCTGCCGAACATATAAATGACGTATCCTCTGTCAATAACCCTTTGTCAAACCTTGACG
CGCTTGCTTGGTGGTAGCCAGCAGAATTTAACGAATTCCGATCGTCCACGTGTCCCACCAGTCGGCAAGCCGTTGGGTCGTAAAAGTGTTGGGACCGAAG
CGGTTCCGCCCACTTGACGCTGAGTCATGGCAATCGCGTCAGTGATTTCGCTAATCGCGGCCACTTGGGCGCAACCTGGATCAGGATATACGCGCCATGG
CTTGCAAATGCGCACAACATAACGTGGCACTCCGACCCTGACACTTATTGCATTGTGATTAACCGCAGGCAGGTACCGAACAGTTGACGTCTCGAACCCA
GTCTGAATGTCGGGCTTAATACCGATCGAGACGTGAACTGGCCGATCCACCGCCTAGCCAAGTGTAAAAATAAGTGTGTACCGTCGCTTAAAACCCCGCA
ATGACCCGGTCTTTTTCCGCTATCTCCTTATATTCATCAAGAACATCTCTAAGGTGTGCCCGACCGAGAAGCATGCACAGATCTAGAGAGTCATGTTTGC
CAGGCGAAGAGACAACTGAGCTGTCAAGTCGATCCGTTTTCGTGCACTTGAAGTCTCCACCCACTAACATCGGTCCAACCTATTTTCGAAGATAAATTCG
AAGCATTTAGAGAACGAACTCCTGGTCTGTCTTCGCACTCGGAGCATAAACGTTGACCACAAGGAGTTTTTCGCCCATGATCCGAATGCGAACAGACATC
CGGTGAGGTGTCCAGTGGTCCTGTTTCCACGAATCCATAGCAGTAATAGAGATTACGGGTTTAATAGCATTGCCACTCCGCCCCGAAGATGTTCGGACTC
TTTCCAGTTCGTGTGGCCAAGCTTGTTCACAAACCCCCAGGTCTTGTTGTATAATTTATCCATGTATACTGACTCCCCAATATCAACCCTGGTATCTTGT
AGAAAGACCAGATGAATGGGTTCCTTACCCTCGCGCTGCCGAAAGTGGCTAAACAACTCTGCACAGCGTTCCGGATGCTTGGGAAATCTAGCTACATTCT
GCGTGTGGAGACAGATGCTGTTTTCGCGAGGCTCCCACGAGTGCTTCGAAAGGAGTCGACAGCGTCTCCGGGGGCTGTCTCCGGACGAGAAATCCCCTCT
ATCAGCAGATGTGCCCTCAGTACTGAGGGTCCAGCAATTGACCATCTCGGGCAACAAGGTCAATAGCCGGCTGCCAGTTGGCAGGTTTGGAGATAATGCT
GAAGACTGCCGCACGCACCTCTTTGGAGACGTGGTATAGTCCCGCTTTGGACGGTCATCACCACCTTCATCTCATTCTCGACAGATACAAGCTTAGGAAG
TAACATACATAGGACATTGAGGACTCTCCAGTGATCCAAGTCCGAAAGCGGTTCCACGAAGGTTGCGGACAACAACTCCGGCTGTAAGCTACTAAATTTT
CTTGAGCGCTGTATGTTGTCCGTCGTTTTCCGTCGAAATTGACCAGACTGACCTTCAGCCAGTGCAGCGCAAACCGTGCACAATCCCCAAAGCTTCTGAT
CAGCTTGTGTGGTACATTGGCGGGTCACAGCCAGTGAGATTCGCTGTTGAAGGATTCCCGAAGGCACGAAGGGTTTCTTCCATCATCAAGACGAGGTAAG
GCATCGGTTACAGCAACTCATGGACAAGTGTCGCCAATCCTAACTCACAATAATGAATCCATGCGGATTGACCTTTTGGACCAATCTGCATTGCAGCAGG
CACCGCGGTAGCAACTTTGAGCTGGTTGACCCATTTACGAATCACCGCTGTGTTTGCAGCAAGTTAATTTCATGCTCTCCAATACATCTGCAGCTGCCAC
TGCAGCCGACGCGGAGTCTAAAATCCTGCGCACTATCTTTAAACGTAAAGTCTGATCGCGCAAACCTTGGGGGTGGATAAGACCCATCGGAGATCGAATC
ACCAGCTGGGTACCCGAGTCCTTGTATGTGCCAATAGGGCGTTTCACCAGGCTAAACCACCATTTCTGGTTCAGCTACGTTCCCTGAGGATGCCTTGAGC
TCGTCCTCGATATCCTGAGCTAGTCCGCCGGTAAAGGAACGCTGGCTACGCACAGTGGAGGAGTAACATCCCCTTCACCCAGATCATCCATGCGCATGGT
ATTTCCAAACGTGAAGGTGCTTTCTGCCATAGTCACACCGCGATGAAGGGAATCCAGTGTTTCCCTGTCCTGAGAAAATGTCGGTCGTATGTCCGGTGGA
GCCGAATATTGTGGTCCAGACTCAGGTGAGACCGCACTAGGTGCCACTTGGAAGAAGGCACACTTCTTATGTCCCGTTTGCGGCTAACGTAAGGCGACAA
CAAGCGTTGAATCGTCGAACGACTCCGATCTCTAATCTTTTCTACCGTCACAGCAGGTATGTCTTGTTCGTGTCATCAGCTGCTTCTTCGCCGCCCAGGT
CGCCGATGCACCAGCGGTGCGATATCCGTAATCTAACGTAGACAAGGCTCCATTCTCATTGGCTAGAGAAGTGGGTAGATCCGTTCCCGTAGCTTCACGA
GCAATGCCCAATTCTAGCGCATGTTCGTAAGCCTCGAAGTATTGAGCTTTCTTGTTGTC