Description :
From Genome Similarity Track
Location :
Scaffold_904:10958- 12466
Transcript NameFunction/comments
g11704.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae
g11705.t1hypothetical protein

Sequence
1508 bases(100 bases per row)
ATCCTCTCCAACGAATTCGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCG
CAACGGGGGTGGGGGGGGCGGGTAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGTTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGC
TGCTCTGCGTCAGGAGCTGAGCTTGATAAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGCC
GCCTTGAAGCGCGTCGCCGCGCTCGAGGGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTTAGTCGCCCAACGTAAAACGT
TGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTC
GCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTAAATTCATTTGTGTTTCCTCTGCCGGTATTAT
CGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGGT
GAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTGAAGTGTCTACGCCCGTCGTAGACACTGTG
TTGTCGTTGCCATGACTGCGCGCAGTAAATCGTCACAGCTGATACATTGCTCGCATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCC
CCACTTACGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCG
AGTTGTTGATGGCGAACTCCGCCATCGATAAGCAGTCGCTCCATTGACGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACG
CTCTGTTTGTCCGTCGGTCTGCGGGTGACCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTGAAGCGC
GGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCGAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTA
CTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCACCAAAGACCACAATACCAGTCCTCTGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGA
AATGGACTGCCAGCACTCCGACGGGGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACG
TACTTGCG