Description :
From Genome Similarity Track
Location :
Scaffold_253:10955- 15337
Transcript NameFunction/comments
Phypl_g6004hypothetical protein

Sequence
4382 bases(100 bases per row)
TACGAATACGCCCGACTGCCACCCCCTGTGCCAGGCGGGCACTGGTAATCCGGCGGCAGCATGTAGTTCTGCAGCGCACTGAAGCAGTACTGCGCCTTGC
CAATGTTCTTCCGCGCGTTCTCACGACGAACACCGTAGGTGCGAAGCAGATTCGTGAAGGCCTCCATATCATCAGCAAGAAGTCCGTGCGAGCGCACAAG
CAGGTTCGCTTCTTCCAGCGTAATCGACATAGACGTGCGGTCCTTGGCCGATTTGCACATCACTACTCGACCGCCACCAACGGAGCGGGCGATGGAGGAA
GACAAGCTCAAAATGGCCATGCGCTTGGACCGTCCGGAGAGCTGGATGCTAACCTTAAGCGCCTTCAGCGACGACTGAATCCGATCGAGGTCCTCTGAAC
CGTAGATAGGAGCGGATGCCTCGTCTCGGCGGTGCTTCTTGGAGACCCATTCTGCAAACTTGCTGACGTAcgcctccagctcgatcACATTCTCAGCATT
GATCTCCTTCTGCAGAGACGCCTTGCCGACGGTGTTTGCAACCGTTTGCATCTCATTCATCCCCTGCGAGAAGATCACTGGCACCACTTGAATGGGTCTC
TGGAACAGAAACTTCGCACGCACCTTCTGCTCTGAGGTCGACAGCGGCAAGTAGATGGCTCCTGAGACTGCGTCCTGCCCTGGAACTCGGTGCATGCTAC
GGTCAGGAAATTCGTTCGCACGACGCGTAATGATCGGGAGCTCAATTACGATTCCCGAGGACCCAGAAGTTATGGATACACGGAAAGCTGCGGCACGCGG
TGACTTCACAGGTCGCAGCTTGATGTGAACACAACCGAGCTCCTTGACGGCCGCCTCTGTGTCGCCCAGCATTCCCAGTTCGTTGCCATACGTAGACAGC
AAGCTCTCTACAGAAAATAAGAAACCAACTCTTGTGAGCATTTCCAGGTAGTCGACCCCGCAGGCCTTCAGTGGATGAGGGCCAAAGTCCCTGTGGTCGT
GCGTATGCACGTAAAGAGTTTGCTGGAAACACGTGACGAGTGCACTCATCGCCTGGCAGAAAGCCACCTCAAGCCGACGCTCTACATCCCACTTGAGTTC
GTTGTacttgcgctccagcgcatCCATTGTAAGATCCGAGCTTGCCTGTGCTTCTTTTACCAAGCGCGCGTGAAGTTTCTCCAACTCTTCGCGCATTTGC
CGCACGCCACCACTTTTAAACCCGTACACATGTGCGGCAAAGGCTCCGACCGTTGTTGTACCGTACATTCGGTGCTTGTAAAAGGGAGGACGACCTTTTG
CATTCGTGTTAATCTCCATGGATGCCTTCTTCGATTCCGCGCCAGACATAGAGCCCTGCGACGAAGAGTAACATCCACTGCTCAGTAGTGCCCGCTTCAA
ATCGTCTCCATCGGAGCCGCTTGAGTTAATATCGGCAATAATGTCGATTGCATCGGAAGAAGCAACATTATCGTCGAGTCCGTAGATGCTCTGGAACTCT
TCTTCAGTAATTCCCATCGCAACAATAGTTTCTGCCAACCTCCGCTGCTCAGAAGGAACGGAAATATCCTGGCCCGCTGCTCCCTTGTTGACAATCGTCT
CCGCAGAATCAAAGGAAATCATACGCCGACGTAGCGCTTCAACAGGTTCAAATGGTGATTCTTCGGACGGGGAAGGAAATACGGCATCTTTCTCGTCGTT
GATATCATCGTCTATGAACTGCACGGAGTCGAGATCAGTCTGCTGTCCACGTACACTGGATTCCCTCGACAGGTGCAATGGTGACGACATCAGAGTCCCA
ACGAACGAGTTCACGAGGTGCGCATAGCGCACTGCGCTAGTTTGGTCTCCGTATTGAACATCTTTTTCTGATGTAGGAGCTGCATTGCCCACAGTCATCA
ACTGTTGATGAAGATTTAGCGCCAGAAAACGTAGATCAGCGTCCGCTTTCATAGTACTTGGCTTAAAAGTGAGCCCAGCGTGTTGGGTGGCTCCGTACCG
CAGAATGGAATCTTCCACCTCCGAAATGTATTGCTCCATCGTCTTGACTAGACCCAAACGCCACTTTCGCTTTTTCCGCTCAATGGCATCATCTTGAATC
TGAATGATCATTTCCGAAAGCATACCGATACTGGTTGCTGGTCTGACCCGGTTTTCTAGTGTGAGCGAAGAACTCATTCCAGAAGCGCTCGATTGCAACG
ACTCCGAGTCATCCGGCGAGTGTATTGCCTGGCCTCTGTCATGTTCTTGCACTGTACCTAGGGCtcttggagaagctggaaTCACCGTAGGCAATGAGTA
GCCACCAACGCTAGGAGTTGAGAGTTGACTGGAGGGAGTCGATGAAGCGCtatcgtcgccatcttcgagcgcGATCTCATGCTTCAGTGAACccagcttc
accagcaagTCAGAGAGTATCAACTGAAGCAGTTGATAAGGTACCTCCCACGTATACACACTTTCGAtcagctcttcttcgaccagcatttTACCCTGCG
TGCGTTGGGAGGTAGACGCAAGATCAATCATCTGCTGGGCTATCTCGGAATAGGCCGCGTCATCGTTCACTGAGCCATCCTCGGCGCCGGTACTTTTAAT
TCCAATATACATGAATGACCGAGTGATTCGCTCAAGCCCGCCAGTTGACATTCCGGCATGCAAGCCCTTAACCTCCGCTTCACAGCGGATAACGATTTCG
CCCGAAGATCGCGTCCGAGATAGGGGGGAATATAGCGAGAAAATGGCTGCCCGCCCAATTGCGGGCGCTGAGCCCACCATAAACGATGAGAGCGAAACAA
GTGGATCACCCACGAGCCACTGGCTATTCAAGTCCTCTAGTGAGCTCAGGTTTCGAACCGAGTACACTGAAGCGCGAAGCAGATCCTGCTCCCGCATTTC
GACAGCCAGCATCATGTGGAAGCATGGGTCTTCTGAATACGAGATTTCGGTTCGGCCAATCTCGGCTAGCACCGCGCCTGTCTCGGAATTCATCAgatgc
agcaccacgaacgaTGATGACCTCACCGATGACTTTGATGGCAGCGCCAAATTAAAGCACTGAAATGATAGCCATGCGCAGGGCGTTGATGAAACAGACT
GCACTGGCCACCGCGACTCGTTATTCCAAGACCCATCGGAGATAGCCACCTGCATTGCCTGTCTCTCGTATTCAGCTGCCGACGGCGAGCCTGCGCTGCT
CCCAGAATCGAGTCGAGAGGACCTGTTGATCGGTTGCTGCTCGTTGCCTCCACCCAAATGCTGCCGCACTACATCTTCCAGCCGTCGTCTAGCACGATCC
AACACGCCGTTCCCAAGGCCTAACGACAGCGGACTCGGCCGTCGGCCAAGCGCCAAGTACCCACCCACCGATCCGGGTGGCGAATTAAccggcgccgtcg
cctgACTCGCCGCCGCACCGAACCCATCCGCAAActtcttcgccgccaccagcagcgagggAGGCATCACGTCCTGGTCCAGCAACGGCGTGGTCTCCGA
CGACACCCTGCCGTTGTTATAGCTCAAACTGCGTCTTGACGGGATCTCCAGCGTCGGCTCCACCTCCCACATCAACACCAGGAACAGCACGCAGGGCACA
ATCTCCGGGATGGCGTACCCGACCACGACGCACACGTCGGGGCTGTGGATATCTCCGCATCCTTGGTGGGAGAACGGTCTCTGGATGTAAATGATCGTCC
GCAGCAAGAACAGCGCAGAGCAGACCCCCATGACCAGGATCGTGAACCTCAACGCCCTCGTGAGTTTCTTCTCCACTCGCTCGTCGAGTCTGCGTCGCAG
TCCGTCCCCCGAGGGcttcagcacgcgctccacgcgGTGGCGCATCTGCCACGTCGAGTACACGAGCCCCAGCGAGCTCACGAAGCTCCCcgtggcgatg
aagagcacgGGCAGCACGCCCGTCCAGAGCGTGGACCGGTCGAGTCTGGCCTTGGCGTGCTCCGCCTCGGCCACTTTagcctcgtgcagcaccgAGAGGC
CCAGCACGGTGGCGTAGAAGAGGCCGTTGGCCAGAACGAAGGCGATCCAGATGCGCCTGGACCTCGTGGAGATCTTGGGGTTGGCGATGTCGATCCAGAA
GAGCGTCTGGAACAGCACGAGGCTGAAGAACAGGCACAGCGCCGCGCGGTTCAGCAGGTTCCGCGCGACGCCCTGGCCCAGGAAGGACGCGGCACGGGTG
AGCGCGAAGAGCACCATGAGGCGCTGGAACGTGCTGCGCTGGAAGgtggcgccgtccgcgcgcAGCGAAAGCGCGCGGCAGGcgcccacgagcgcgagTG
TCAGGTACAGCgccacgcacagcagctccagggcggcggacgcgcgcggcaggaagacgaggccgtcgtccacctgctgcgG