Description :
From Genome Similarity Track
Location :
Scaffold_38:109548- 115726
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08482Hypothetical protein
Sappa_CBS223.65SPRG_08483Hypothetical protein
Sappa_CBS223.65SPRG_08484Hypothetical protein
Sappa_CBS223.65SPRG_08485Hypothetical protein

Sequence
6178 bases(100 bases per row)
AGGCGATCTTAAACTCGCAGTATCGAACGGCAAAGTCGCCGAGCTCGTCGAGATCGCGCTCGTGCTCGAGCGCTGCCCATCTCTCGCGCAAGTCCTTTGC
ATCTCTCAAAAGGATTGCCATCTCTGCATCGCGAGCCTTGATGTGTGCATCACGAATCTGGCCGTTCTTCTTGAAAGCAGCCATGAGCTCGTTGTAGCGT
CTTTCCTGTTCCTGAAAGTACGCCTTGGTGTCCATGAGCTTGTCGTACGAAATGTTGAAGGTCGCTGGGACGCCCGGATCCGACTCGCCACTGAACGAGC
TAAAGACGCTGAGGACCTTCGGGGTCCGTGGGAGTCCCAGCTCGTCTTGGAGCACAAGGGGCCAGTCGATCGGGTTGCTGTAGTGGAAGTAAAAGCGGTC
CGGTGCTTCTGGCGCTAGCTTGTGCCGGGCGACCACGAGCGCAAGTGGGCGAGAGCTGGGGATCGAGAAGAAGCGGCGCGGGAGAAGCGACCCGTGCTGC
GAAGTGTGGCGAAGAGCTGAGAGGATGCTCATGACAGAAAGGTCTCGATGTCGGATCTCAACTGACGCTCTAGAACACCTCTCGCAATGTATATTCTTTT
TCTGACGGGGCAACGGCGTGAACATCCATCAACTCAATTCCAGCTTGACGACCTGTAAAATCAACAGAACGCGTTGGTCGCAGACGACCGTCGCTGTTCT
GTTGCTGTTGACTTTTGAACGTATCATAACTACTGTACTCTACTGTGCAAACTAGGGTGAATCCCGTGTTTTCTTGGGGCAGGAGCTCTTTGGTCGAGGT
TTCGCATTGGGGTAGCGTGCAATCTAGCGGTGGGATCGTGTACTGCGTGTGTCGTAGTTTGGACTCGTCGGTGTACGGAATCATGTGCATTTGCGTGCAA
CGTTCAACGTACCCTGCCCCACACCTCGTGTTTTCTTGGGGCAGGGCGTGGTTGATCTTTGTGGTTTAGATAGGGCCGGTGGGCCATCTAGCGGTCTTTC
GGCGTCGCATGCGCAGTAGTTTCGTTTGTGTAGAAGGTATGTGCAGGGTGCAGTGGAATCTTTTGGTTTCAGTTTGGTATCGGGGCAGCGTGCAATCTAG
CGGTGCGTCGGTGTCGTAGCATGGACTGAGTGGATGCCATCAATCATCGGTGTTCGCTTTCATGTACCATTCAGCACACCCTGCCCAATGCAGAAACGCA
TTCACATGGCAAATGTGTGATGGGCGCGTGCGCCGAAAGCGACCTCCGCTTCGCTGCGGTGCGCCGAACGGCGTCGAATCAGCTATGTACTCGGCCCGGC
CCAGCTATTCTACCCGTCTCGTGATGCAGTGCCATAATTTCGTCGCTCCGTCGCAGGCCGTCCTACACGCGCGATTTCCCAGAAAGTGCAGCACGATAGA
CAATCATCCAAGCCGTCGGCAGCAAACTAACATCGCAGCTCCTTGGTTCCTTCCAGTGGGTTCCTTCCATCGCAGTCGCTGGTGCCGCGGCGCTCGCAGC
TTGGCGCTGCCGCGACTCCCGCACGCGCTGGTCGCCCAACACTGGCGTCCCAACATGACCGGAGCTTTTGCTCTGCGCCTTCGCGCTACACTCGTGGTTG
GCGCATCGATGCCAAACGCACTCGCAACGCGCGCACACGGCATATATAAGCGCCTCTTTACCATGACCACCATCATTAACCGCCTCTCTGCGCCGCGCCG
CCACATCGTGGCCGAGCGCGCGCACACTATCCTAACACGAAGCCGTGCACCATCGGAGGTGCCCACGCTACGGTCGTGGTTGGCGCATCAATGCCACATG
CACTTGCTCTGCTCGCACATGGTCTATGCCCCAACCGCGCTACCGCGCGCTATCCATCCACCGCCGGATGCAAGCGCGCGAACACATCCTACCGCGCTGC
CGTGCACGACCGCAGGTGCGCACGCTACACTCGTGGTTGGCGCTTCGCGCATCCATGCCAAAAGCACTCGCTACGCTTGCACATGCCATATGCCGTTACC
GCGCTACCGCGCGGAATCCAGCTATCGCGGGATGCACTCGCTTCGCTCGTGGCGCGCTGCGCGCGGATCAGGTCCGATTAAGTGCGATATGATAATACTA
CAAACACCAAAGGCATATGCCACAACCGCGCTACCGCGTGGACTCTGGCTACCACCAGATGCACTCGCTACGCTCGTGGTGTGCGCTACCGCGCACGACC
CGGCTGCGCCGGGTGCACTCGCTTCGCTCGTGGCGCGCTGCGCGCGGTTCCCTTAAGTACGGATGCGCACTTGTAACGTTGCTACAAACACCAAGTCAAA
AAGTGTGACTTTAACAGGCCAGACGTACTTAACCGAATGTGACCCTTCCCGACGCGCTACGCGCGTCAAAACACATTATTTAGAGCTCCAATAACGTTGC
CGTGCTAGCGCACGGGCCCGGCTACCGCCGGGTGCCCTCGCTGCGCTCGTGCCGCGCTTCGCGCAAAAAAGTCCTTATTCAATTAATAGATAGACAATCC
AACGAGCAATGTGCTGGAATGCTTTGCCGTTCGTTGCCACGGTAGTCTTTGACCCTGTCATCGTTGTTTTCGCACAAGAGAACTCGTGCGCGTCGCACTT
CTGGGTCGTTTTCGGACGCCACAGGCTGTCAAGTCACTCAACAGCCTGTGGCGACCAGAAGAAAGACGCAACTCGAGTCCCTCTCCTGGTCGCCGCCCTC
GTCTTTGCTCGGATGGAGTGTGTTGAGAAGTTCCTTTTGCTTGATTTGAGATGGAGAGGACCGCTTGCCGAGGTACGAGGCGAAACAGTAGTAGAGCACA
AGAGCGACTCGGTGCGGGCGGCCATGTCCTTGACATAGACGTACTAGTACAGTAGAGCTCGTACTCCCACATGCTGCCCATGATGCGCTGGGACAAGCTG
CCGCAGTCCAGAGATGGCAAGTTGTTGGGCCACTTCTCAACGGCATCATTTTGCGCCTGCCGAGCTGGAATTTCAAGCGTGCCTTTGCAGAGGACGCATG
CGTGTTATATGCAGCTGCCCAGCGCTCGTAATCGAGCTTGTGCATACGCGTCGTGTTCTGACATGGTGTGCAGTTATCGACGCCTCTGGATGACGCTCGG
CTGCCGTTGATGGTCGATGTCGCAGTGGTGCGGCCACCTCGTCGATTGTGACGAGCTGGGCTGGTCAATGCTTGTGCCAGCTGCAGACAATCCTTTTCAA
GAAATGAGCCAAAGCGCGCGTTCTGGGTACCATATATCTCAGACTTGGCGCCTTTATGACCCCCGTGCGGTAGCCACGATACCACCTCGCGTCGTGGAGT
TTGGATTTTGTACGCAATATGGAATAGATATACAAAGTATTTTCATTTTTATTGGAATCCACTATATAAAAGAGTGCTTTTGTAAGGCTGAGCTGAATGG
CAAACCAAAATCCGATATGGACTTTTAGTCAGAGTTGGGTGCGCCTCGGATTGGCGCGGCCTGTCTATCACACTTCAAGTCGCGGTCACTTCCAAAGATT
CCACGCGCATGCAACGTCGCAGCAGCCGGTCTTTTGTGCCCATGCTGACAATGCTGGCAATGCTGGCAATGCTGGCGGCGGCCGCAAACACCACCAGCTC
ACTCCCGACAACGTCGCCAGTGACTGGAGTGCCGTCCACAACGGCGCCTTTAACAGCAACCAGCAGCGCAGTACCAACGTCCAATACTGCCGCGACGACC
ACCGTCCCGCCGACCGCGACCGTGACTGTCGTGACGGGTACGCCTCCGAGCTCAACGCGTGCAGTGACTCCTCACGTGGCGTAGACCCCAACGCGACGCT
CCACACAACGCTAACCTTTACGCTCGGCGCAATTTGCGGCATTCTCCTCGTCGTCATCGTCCTTTTCTTCGTCAAGCGCAAGCGCGAGCGCCGAACACTT
GGCCACGACAGCCACGGACTCTCGCCAAGTTTTCTCTCGGTCGAAACGCCGCTGCCCGCGCGATCGTCGTATAAGTCGACGGTCTCGACACCCAAGGTCG
CCGTGCTAGGGCCCTGCGCGGACGAATTCGACATGGACGTCGCCGCGCAATTCGAGGCGCACCCGCGGGACTTGGACCTCCACGAGATCGACAGCCCGTA
CTATGTGTCGGACTCGTCGAGTGGGAGGCGGAGCTCGTCCGACCTCGGGTCCATGGACTCGACGCGTTTCGAGGAAATGGTGCGCATGAAGATCAACCTT
TTTTAAGCCGCCCGCGGCAAGCGGTGTGTCTATTTAATTATGTCAAGTTGAACGTTCACTAGATACCATTCTCGTGAACTCGAGTCGCGTGCTGGGATGA
CGGGCAGTAGTTATATCAGATGCAAGCGACGGCGTTCGGACCGCTCGACAGACCAAGCTACTACAACTAGAAATAATCAACTAGTATACAGACTGCACGA
GACGCGTGATTGTTCGATATCTCGTCACATCAGTCAGCCCTCCGCCCTGCGACTTGTATCGGATCGTGTGGCATGTGCCGAAAATAGTTTCATTGGTCGA
TCGTCCAGCACGATCGGTGATTGGACAAAATGCGCTGCGTTGCACGTTCGACCGCCATGGCGCGCTTCAGCGGCCACATCTACGACTTTGTCGCGTGGGA
GGCAACGCTGATGGCGATGCTCGCCAAGCGCCAGCGCGACGTCGAGGTCGTATTTGCCCAGAAAGGCCTGGCTGCGCCTGCTGTCTCGTACATTGAGCTG
CTCACGACGCCCGAGCCGCCGCCGTCCCGCGTGCAATCCGTTCTGATCACAGACCTGCGCAAGACATTGTTCGCGAGCTTGCCGTCGGCGTTTGTGGCCG
AGTGCCTCTCGAAGGACATGCCCATGCACAAGCTGTGGGCGGCGGTCGTTGACGAGTACCATCCGTCGTCGCACGCGCCCATGGAGCGCGTCCTCGCCGA
CTTGTTTGATGACGTGTTTGACGCAAACTTTGACTGCATCCACGAGCTCCTCCAGCGCATGCACAGCATCGTCAGGAGCGTCAACGACTACACGCGGCGC
ACGCGCGGCCGCGCGCTCCTCACGGACGAACTCGTGCTCGAGCGATTGCTGCTTGCGCTGCCAAAGGCCTGCGCCGACCTTGTGCCACCCGGTGCCGTCA
ATCTCGACGCGTTCGGACAGCGACTCGTTGAGAAATACGGAGATATGCCCCGCAGCGACATTTTGGTGTCGTACGAAGGCGACCCGCCATTGGCCCAGCA
AGGCATCCCGACCCGAGACCGCCTCTTTGCTGCTAAGACGCCACCATCAACGAAATCCTTGCTGCCGATCAAGCGCAAGTGCGCATCGCTCGACTCGGAC
GTCGCGCCCAAAAAAGCGTGCTGTCTCTAGAGAGATCGTCTTGGTTGTGCTACGAGATAGTATGGTGGTATGTTCATCAATGGAATGCGTTCGTGATAAT
GGATCGATGTGTTCTTCGTCACAGGTAGTAATGGCGCCGTCCTTGCGACCGATGGTAGTACCGCGCGCAGGTGCGTTCGGTCGGTGGGTGCGACGTCGCT
GGTTGTGTGTGTCCAAGTGTATACTGGAGGCAAAGGGGACAACATCGCAGGGTTCGGTCAGCACGACCGTTGCAGTGAGCCCGCGCTGTCATCGACTGAC
GCGCCGACATACAGGCGTAGAAGCCCAGGTAGAAGCCTGCGGCTTGCGGGGCGTGGCACTCGCGTCCATTACAGACGCCACGATATACGCTATTCTTGAG
TTTGAGCCCGCGGTATACAAAACGTGGTATGTTTTTTCGATGCGACGCCAATCGAGACTCGGTTTGAGAAAAATCCATGCACCGCGTCAATCATGGCACG
GATCAGGCTCACGCAGTCTGCACGGTGCTCTCATTTCGGATCAAGTCGGCAAGATGACAAAGCTCCTTGGACTGCTGGCTGCCTGCGCTGCACTGGCCGC
CGGCCAAGGCAACGACACGGAGCCGCCGACGACGCTCTTGCTCGAGCCGACCACGATGACGCCGACACCGACGACGGTGCTGCTCAACACGAACCTCGGT
GCCAACGACGACGACACCGCTGGAAACACCGACCACGACGCCGACAACGACGCCCATTGCCACTGCAACGCCACGACCGACGATGGCCCCGACGACCCTA
GCCCCACAGCCCGAGACCGCGGACCCCGAACGTCCGGACACCGTGGGCCCGACGCTTGAGCCCAACACGTCGGCGCCA