Description :
From Genome Similarity Track
Location :
Scaffold_734:10954- 21173
Transcript NameFunction/comments
Phypl_g10641hypothetical protein
Phypl_g10642hypothetical protein PHYSODRAFT_506421
Phypl_g10643hypothetical protein PHYSODRAFT_560624
Phypl_g10644hypothetical protein

Sequence
10219 bases(100 bases per row)
gacaATTGCTGGCATCGTTGCAGACGCTTTCGCTTCCGCCACCACGTTTGGATCGTCGTGGCGTACGCGTTATTCCACATGAGCGTTAAAATctcttggc
ggcgctgaTCCTCCATGCGAACCTTCAACTCGTAAAACCGGGCTCGTGCCTGCTTAGCTCGATACGCATTCTGAAGCAATACAGCGGCAGCGGTCTTTCT
CTTGGAAGCGATTTCCACACGTAGTCCAAAGCAGCGTATGCACCGAGTATATCGGAAGAAGTTAAATATCACCCGCCTCGCGTTTGCTTGTCTCTCGTGC
TTCGCTGTGGCCTGTCCAATCCGCCTTCTTGTGCGTCGCATCCAAAGCTGAATGGAGATTGCTGCATGGTATCTTGCGAGATGATGGCACCAAGCAAGGC
AATCCCGCTTTTTCTCGTTGTACCGCACAAGAGCACGCGTGATCACACGACctgctcgttgctgctcgatccAAACCGCGCAACGCACTCGAAAGAGGTA
CGAGTGGTAGAAGCACTGGACTCGATGGGCAGCCACGTTATACTCAATGAAGCGTTTTTTTCGCTTGAGCGTTCTTCTTGAATGAAATCCTCGCCAACCG
GCTTGGATCGATGTCGCGGCGTGATGCAGATGATGAACAGCCGCTGCTCGTTTACCTCTCATGCCTCGAATCCAACTTTGAATGGCTAGTGTGGCAGCAA
TGATTTCGTTCTCACGTTGGCAAGCGGTGGCTGCCATCCATCGGCCCCACAAACGAAACACTACACACTCTAGTCTCTTGCGCGATCTCTGAAGCACCCA
TAACCCGCATTTCCTGTGGAGTTCAAAGTTAACACAGACAAAACAAGAAAGTCAATTAGTCAAATTCACGAGAACCATTGATGTGGGAAATCGCAATACA
ACAGTAGACGTACAGACGGCAAAACTTGTGGACGCGTTGGTAGCACTGTATCCACATCATTTGCTGGTGCCAATGAGCAAACCGTCGGCGCTTGGCTTGT
TGACAATACCTGGACATGATGATCTGGTCATTACGTAGGGGTGAGTAAGAGCACAGATCCGTTTTGACGATTCTCATACCGCTAGCTTCTCGACTGCGAA
CTGTTTTCGCATAGTCACGGAGCGAGTAATTTCTTCCTTGCAGTGGTCGCGGACCCACTCATGAATTTCAAGTGGGTAGAGCTCCACCTTTCGAGACGCT
GTCTTAGTAACAGTAAGCATGCAGTCTTGGAGTGGCATCCTAGTTTGCTTCTGCGGCAGCTTTGCCCGTGTTGTGGCGCGGGGTGGGATTCGTTTAGGCA
CTATCACCTCTGGAAGCATCACACAGATTGTTCGCACGGTGGGCAATACTCGGCCGTGAATCCATGCATTTCGCGCAAGCTTATCGCACAACGAATGGGG
CTGTACTTTTGAATGACGAGTAAAACGCCACTCTTCTTGCCGACGGAGCATGACCAGAGCCATCTCCAACTGCATCACTTGATCGTACGTTAAATCCAAT
TCTCTTAGAAAGCTCGCATTTTCTAGCGTGCTAGCTACATTCGCGTGGGCAAGCAAGAACAAAATGTCTTCCAATACCAAGCACTGCAAACGAAATTTAT
CCTCCCAGAGCGTAAGCACATGCTTCCGTAAACTGCTTGTTGGCGTCTGGATGTTGGTGCTCTTATCAGAAGGCATTAGGAGAGGTTGCCCCGTTGATGC
ATCTGTCAGTGGTGATCCCAATGAAGAACCACGGGGTACGAAGTTTGCTCGTAGTGGCACCACAGATCCCTTGCGTTTGATTTGATCATTAACGACATTC
GTTGCCTTGCGCTTTTTTTCGTCAACACATTTCTTGTCAAGTAGTCTCGGCTCCAGAAGGTAGTGTGCCTCACTAAGATTTCTCTGCTCGGGCAAAATTT
CATCCAAAATGCCGCCCACACTCCATTTTGTCCCACCAAGagcggcaagacgctcgacCAAGGTAAGCAATTCTTCAGCAATCAGTACGAATGTGTGTTA
CTCAAAGTGCCAAGCTTGCTTTATTTTTTTCACTCACACGGACAGTACCTGCTCCTTCACGCCTCCTAGTACCCTCATTGTTCGCCCCGACAACCCCTTC
TCGTCCCTGCATCGATGACTCTATAGCTGATTCAGCTTTGATGGAAACGGCTAATTTTGGTTGTTTCTTTACTCGAAATCAATGCGCAAGTTTAGCTCCT
TCGCCTCCATGAACTCGAGAAGTTCCTGGCAGTCCTCTTCACTCAAATAAGGGCGCATCACACGTAGGCCATCCAGGTATAGTCCCTTGCTCCACGCGCA
GGCTGCAATTCCACGATATAGCACCTTCTTCGCCGCATCAACCTTTCCTAGGGCGACCTCAAAGCGGATATACAGCCCCCAGCACAGCGCGTTGCCTTTT
GTCCGAACCTGGTTCACCATGTTTTCAAACATTTGCCGGATGCGTGTAACGGCTGTCGCGTTCATGCCCCAGCGATGAAAGAGACAGCACATGGGGCAAG
AGGGTTTGTTGGTGCTCGACTGTACATTCTGGGATAATTCCTGGATCGTCGCGGATCGTTCAACACGGCAAAGTTCACAGAGCAGCGCAAACAACCACTC
CACCAATTCCGGTGAATCGTAATGTCGCCGCCATCGCTTCTCTACTCGAAGGAAGTAGGTGCGGAGCACCTGTGAGATCGTGTTTCCCGTTTCAGAATCG
ACAAAGAGCCGAAGAAATAGCTCGTTGTTCGGGAATTTCTCCACTGCCTCGCCGATTGACGAACGCCATACACGAGGAGCAAGTGTGGGGAATAAGTTCG
AGGCTTCGTGTTGCTGCATGAATTCAAGGAAGCAAGTCCACATCCACGCTACATGCGAGCAGGTCTGATGCTCTACGCTGGCCAAAGCATATTGATATTC
GTGACAAGCCGCATCGAATCCATCATAGGCATAAACGACGAGTGCCAAATTGTGCAAGCAGTAACCAATCCAGCAGTTGGGCCGATACCGCGATCTAGCA
CTCGGTTTGCACTGCTCAGAATTCCTCGGAGTAGATTCGGCGCAATGCTGAACTGCGAAGCCGAGCTCCGCTCGATATCTCGCAATGAGATCAGGTCCAG
TCGACGGATCAGACATCAAGCGTTCCTGCAGGTAATCACTAGCCCGCTTCTTGTGTTTCTTTTCAATCTTTTCCAGCgtttccttctccttgtcgtccag
TTGCTCAGGTTTCCACGCAGCCCATAGTGTATACAGACACCGCAATATACGATGCTTCCCTTGCTCACGATTCTTCTTTTGATCGCCAGAGAAAGACCAC
ATCTCTAGACGTGCTCGAAGAAAGACAAAGCGATGGAAATTTCTAGCCAACAATGCGTTGTTCGGGAATGGAGATCCAAATGACTTGAGAGTATTCTCAC
AGATTCGTCGGACTTGGCGCTCGTTTCCCAGCCTaagctccagcttggcgtagGCATACAAAACACTAAAATCTATATCGCCGTCCGCGGTATTCTGGGC
AAACTTCTGACTTACACGCCGAGCATATGCAAGATTTTCCTCTGAAGCACCGATTGAACGCGTAACCTCAGCTTCAAAGCTAATCCACAAGCACTTAAGC
GTGCTACCAAATTTTTCATCCGAATTCTGGTAGATATCCAACGCTTGGGCGAATACTCTACGGGCAAAAGCCACCTTACTCGGATCACGGAGCACATCTG
GCTTCACTGCAATATCTCCAAGAAGGGCATTCTCGAGGAGTATCTTTCGGCCACATGGATAAAGAAACAGCGTGTGATTACTGGAGTTGTCAGCTTGAGG
GTTAAGCGCAGATAGGATCGGAGCCACGAGCAGTTCGTAGTCTGCAGGGCTATCTGCATATATTGACTCGCAAACCGAGAGGCTACTCTCCCAAGAATAT
TCGCCTCGCCACTCGACACCGCATATCTGCAAAATCTCGGCAATAAGCCGCCATTGATACGCCACTGGAACAGAAAACAAAAACGGCTGAATTTCTTCCG
TGAGCGTGGCGCGATCCGGTTGTTTCTCGATAAGGTCTTGGTGAAGAGGGTTGTTCAAGCGCAGCGGAGACCACTGCAACTGGGTCTGTACTTCTTCGCG
CATGAGCCAATGTAGATAGCGGTCATCACCGTCAATAGAATCATACTTCGCACGTTGGTCCTCTACTTGTGATTTTGTCACGGCAAGCACTGCGTGTTTC
ATCTTCTCTTTTTCAAGCAGTTGAGATTGATGAGCACGAGCATTTCCTGTACCGCGTAACTCGCTAAGAATGCGTTCGTACTCTTTGGAatcgtcggcat
cgtcaaTGTTAATACGATACCCATGCAAGTTGCTGTAGATGAGCTTGCCACTTCGTCTGGATTCCGTCTCCGAGCCGTCACTTGCATAATTTGCATAATT
TGAGTCAAACTCATCGTTGACCTCTTTGCTATCCGCAGCTTGTGTTTTACCATGTACGCGTGATTGACGTTGGTATGCTGCAGAAGCGGACAGTAAACTC
TGCTTGTGAACTTTAGTGCGCAATACTTCCGGGGGGTTTACTTGACAGGCAGAGGTAACACAAGCTGTCTGGATGTAGTCTAGGAACTCAGCAACACATC
GCTTTGGAGCTTTTTCTTCCAATGTTCCAGTGCTCGTCGCAGTCTTACCACCCCGCTCTTCACCAAACCCAAGGGCGTCTTCATCATTCCATCGTAAAGC
AAACGTTCGAAGCATTTCCAAATGAGTTTCATGGTTGCTACTCTGAGCAATCTTGGCGCCCTCGTTCAGGCTGAAATCAATTAGAGCTTGCAACTGAGCG
ATTGAGCGCTCGATAAAGCCGGCCTTTTTCTCGAATAAGCACATGAGAAGGTGGAAATCGAGCAGTAATACTGATAATTTCTCCGCTTGTGTGGGTAGCT
CTTCACTTGAATCTGGGTGTGATGGTGACGCGGTAGTCGtcattgctgcagcacttgcgcATTCTCCTCTTAAAACAGCAAGTATACGCGCGTAGAGATT
GCGTACAGACTGCATCGAAAAACGTCCAAAGTGTTGGTGGTGACTTTGAAGTAGCTTGAACCACAACTCACTGTTCGTTAGATCTTCAGAGAGAAGAGAC
TCAAGCTGCCGCTGAAACGAGTCAACATCAGCACTGTTACCACTCGCTTGAGACTGCAACGACATGTTCAGCTTTACGCGATGCAATTCCCGTGACTGAG
GATTATTCGCGAGAGCTCTTGCTAGAATTGCCGCTTGTTTTTCCACGACACTAGCTTTCATCGCTGAACTCAATCTTTTGATCTTCGTGTGAAGACGCAG
TGTCTGCTCTTGAAAGGCCATCAAATCGAGCCAAGTGTCGATGTCGTGTGGGTTTGCTGCTACAGCAGCATTGAGCATTTTGCTGCGTTCCACCAGGTGT
TGTTCCACGCTTTGCCCGTCAGTTAGCAGAACTCCGTTGGTGACATCACTTTTATAATCGCGCACTTCATCCGTATTACCATCCACAAGCTCATCAGCGT
TAAGCACCGGGTCAAGCGGAATGAATGCCATTTCAGGTGGATGGCTCACGACCGCATTAGCACTTTGGTCTGTTTCATTGCTGTGATCCGCTTTGTGATG
AGCTGCCGAGCGAGACAGTCGTTTCTCCGAGTACGCAAGATACAGCCGCTTCTGTCGACTATTCCTCTCCATTTTGCGTGCCTGCAGCGAGAAATATCGA
TCCGAGGATAGCTTATCTTTCTCCTTGCCAGACATTTCGCTGCTGGTGTACTTTGGTCGTGATTGAGATACCCATGCACCTGTGAGCAGGCTCCGTCGTG
TAGCCAACTCGTACAGCGGCTGGTCATGGACATACGTGGATCCGAAGAACTGGTTCTCGCGGTCACCCACGCAGTCGAATTCGAAAAGGTTGgcctctgc
ttcttggtcgtgTACCACGGCATCTTTTGCCGACTGCTTCACGATCCTGGTCTCGTCCCTATGGGTGCGCGACCGGGAGTTGCTGGGGCtacgtcgccgt
cgtcgtcgagagCGGTGGCTGGAGAGGGGACTCTCGTCGCCatctctgctgctgtcagaGCGACTCCACGACCTGcgccgcttcttgtccttgctCATCT
TAGCGAGGTGGCGACTCTCGCGCGACGCCACTGCCGTCgactcgtcgctgcgtcgcttcttctccttgtgtctcttcttctccttgtgaCGATGTTTACC
GTGTTGATGCTTGTACACTTGCAAtgccgactcggacgactcCGCTACATTtcgcttcgtcttcgcttTGTCGGCGGCACCTTTGCCGCCGGAAAAGCTC
TTGCCAGCACTCAGCCAATCTAAGACGCAAGGATACACAGCGTTAGTACGTCGTCGTGAGCGCCTGCCAACGGTCAGCTAGCCTACGTACCGTCGGTACT
GTCTTCAGCGTCTGCATCGACGCCCTGCGCCACTGCCTTCCGCCCTGCTGCGAACATGCTGCGCAATTGGACTATTTGGGACTATCAATGTGCATCAGAC
TCTAGGTTTAGTCCGAATTGTAGTTCCACGAACGCAATCATCGGCAGGCAATATGAGCGGGAGGAAGCTCGCAATGCGGGCGCCGCCTGTTAACCTGAgg
aacgaggaggaggtctCCGCCTacatcaaggagaagatccGCGTGTACAGCAATTTCCCCAAACCTGGCGCGGACTTTAGCGACGTCACCTCGCTGCTAT
TGGATCCCGTGGCGTTCCAAGTGGCCATCGACGCACTGACGTTGCGGTACGCGGACCAGGGCATCACGCACGTGGTGAGCACCGAATCAAGAGGCTTTAT
CTTCGGCGCGccgttggcgttggcgctcCAGTCTGCGTTCGTGCCGGTGCGTCGCGCCCGGAGACTGCCGGGAGACGTCGTTGGGGTGGATTACGTGTCG
GGCTTCTACCGCGGCCGCATGGAAATCCATGAGGACGCCATCACGAACGGAGGACGCGTTGTCATTATCGACGATCTGGTCGCTTCGGTGCGGTAGTAGC
GTGTAGCCATTGCATTGTGCTCTTTCGGTAGTCGCAGCGAAGCTCATGGTTATGTCGGTAACTGCTGGTGGACAGGGGAAAACGCTCAAGGTGAcggtcg
agctcgtcgagaagctcggcgGAGAGGTGGTGGAGTGCGGCTGCGTGATCAACTCGCTGCAGGCGATGGTGCGGTTGCTGTCTGTCGCGCTGGCTAGTTG
TTTGGTATTGCCGCCGACAACTGACCACTGCCCTCACGTGTCATGTACCATACAGGAATCACTGTCGGACATCCCGCTGTACGGCCTCACGAAGATGTGA
ATAGAGTGCATGGGCATCGCGGAGCCAGCGGCGGGCGTGAAGCCGAAGTTGCCAGTTCCAAACCTATCGTCAGATTCTTGAAAGTACCACAGCTCCTGTT
AAATCACATAGCCGACGTATTTGGTTTAGAAGGTTTTGGGTGATCCCAGATTCTGGCCCTTCCGGAATCAAAAAACGAAAAAACcgcgacggaggagaag
caagCTCGCTCTGCCTGCAGCATGCCGCCCAAGCAGCGAATCCGCCAGCGCTTCGGGCCCGAACAGGACTATCTCCTGGCCGTGCAGGTGGACAAGGACC
TGCCGTTCCGCGCGCCTTACGGCGGGCTCATGGCCGGCTGGGAGAAGGTCGCCACGACCCTCAACGCCTGCAGTGCCTTCAAGATGCACCACCTCAAGGG
CCCCATCGCCAAGAACCGCTTCGAGCGCCTCGTGGCGCGCCACCGCAAATGGGTCAAAAATGGCAGCCACCCGGACGACGCGCCGTCGCAGGACGACGCT
TTTCAGAGCGTCATGACCGAGCTGGTTcccaagctggacgccgccgagtcgGAGCCGCAGGTCCAGACGCTGGGCAAGCGCGGTCGCCCCCGGAAGATCC
gcgccgaggacggcgcggcACCCGCAGAGAAGAAGTCGTCACTGGCGTCTGCGCAGGTGACCATTGCCCCGTCCCCGTTGGGGCcgcagccgtcgtcgtc
gtccacctcgctCCTTGTGGATTCTGAGGACCAGGCGCTGCCGATTGTCACCAAGACCACCCGCCAACGGTTCACTCCTGGAGACGACCTCTTGCTCGTC
AAGTAcgtgaaggagacgctgccgtTCCGCGCCAAGTTTGGCGCGATCTCGGCGGCGTGGGAAGATGTGGCGAATAAGCTGGACAACAGCCCGGAGTTCT
CCAAGGACAACATCAAGGGCCCCATCGTGCGCTACCGCTTTGAAAACCTCGTGTCCAAGTACCGCGAACGCGTCAAACGCAATAACGGCCGCGTGGTGGG
ACCAAAGGGTGCCCCTGCGGGCGAACTTGAAGTGCTCATGACGGAGCTGGTCACGCTGTTGGACGGTGGAGACCCTGTCAGTGCTGCTCTGCTTGCACAA
AACGTGGCGATCGCTACTGGTGCGGCCACTGCGGTGGCAGCACGAGAGGCCCCTCGTGCATCTACGACCCACGACGAGgactcgaccagcagcacaccaa
gcgagtcgtcgtcgccggccCCCACTTCCTCTGAAGCCGCCTTATCCTCGACCCAGAGCTTCACCATCCCTACGACGGAGCCCGAGCCGGCGGTGGTGCC
AAGATCAACGAGTTTGTCCACGACAAGTGCCCCTTCGTCGACCGCGAATCTGGCGACGATCTCTGCTGTGCTGAATGACACGGACCCTACAAGTATTGCC
GAGCTAAAGGCGCTGCTTCAGGAAATGGTGGaacagcagacgcaggcCACcgagcagatgctgctgctgcagcgcgaagagcgCCGCCTGGAGACGGAGC
GGCGAGAGCGGGAGCTGGAGCATGAGCGTgaggagcgcgagaaggacCGCCAAGCGCTGACGTCCGCGGTGATTTCTGTCATGAAGACATTCCTCGAGCA
GAACGGCCGCAAGAACTGAGAAGAGTTGTAGTTCATTTAAGGGCGCTATCGTTTTAGCAATATCTCTGTAGCACAGTACCGGGCCAGCATTACCCGCGTC
CATTAAGTCCGTTGAGGCCACTCGACTCGCATTGCGAACACCTCGGACACCTCCTGAACATCGGCGTCAACTTCAAAGTAGCAGCTGAGGATTTGTCAGC
ATTTTTGTGCGAATTCCCAGTCCAGCTGGGATCAGGTATTTCCCTCCATCAGGCCACACTTCAGAAGAACGTCTCCTCTGGTCACATCGAGAAGCGAGGA
CCGACCATGCCCGGCAACGCAAGCTCATGCTTcgccagcagttgctgcgcgagctgTTGCGCCGGCGGAGGCACCTCCACGAACGACACCCACCGCCGAC
GCCTCGCCGATGACGacccccgccgccgcgatTACGATACTTCGCGTGACGTGACTGTACAGCCTGTGGTGATGTCCCAGATCCGCCCGCCGCAGCCCCA
AGTGCGCTCGAATTCGTAGAGATGGAGGGGCAACGAGGGAGAAACACCATACATGTATTGCTTCAGGCGCCTCGGAAAGACCAACTTGAAGTGGGTATTA
GCTGTCGCCGGAGATAGCTTCGATTCAGGAAGGAGCAGCACATCAGTGGATAATGAATACATTACATTGCCAGCCGCGGACGGGCGTCCTCTTGCACAGA
GCGCGCAGTCCGCGGGCGCTGGTAGATTATGATACACTGCACAGGGTGAATAAATTGCCGTAGCAGATTTTCGGCGTGTTTTTGCTTGTGGCCTGAGACA
CCATCCACTTACAACCACCAAGTGTGCACACGTCGCAGGGATGATCAAAATGCTAGTGCAGGaatggcgagcagctcgccgcgaACTCCTTCGGCTCGCT
CGCTCACGGTACGCCAGAGATCGCTCATTTCGAGACTTGCCGGCAAGTGCAAGAACCTCGAAGGTGAAACAACGAGTTCAAGACCCAGCGGAGTAAGCTA
GCAACAAGTTCAAGGCAACCATGTGCGGACCCGACGACGGCCCCGGCATGGACATGTGCTGCGAGGACGAGTGCTGCGGGTGCCTGGCCGGCTTGTGCTG
CGCCTCGTGCTGTCTAGCGGGCGCCTCAGCGGGCGACAACGATCGTCGCGATCGCCGTGGCTACAACTCACCTTCTCCGAGAGAAGTGTACGTTCAAccg
gtggtggtgcagcaagGCTACGCAcacccgccgccgccagggTACggtccaccgccgccaggATACGGCCCACCGCCGCCAGGATATGggccgccgcccc
cgcgcCGTGACTACTATTA