Description :
From Genome Similarity Track
Location :
Scaffold_20:1095376- 1097454
Transcript NameFunction/comments
Phyin_T30-4PITG_10765Beta-glucan synthesis-associated protein%2C putative

Sequence
2078 bases(100 bases per row)
TCGATGAGGTCAATGTTAAGTGTCGATCATGAACAAGGCCGAGAAGGGTACATCTGCGCTAATATCAATCAGCGAAGTCAGCAGTGCTGACTCAGCACTG
CCAAGAGCAACAGGAGAGAAAACTACGGCACCAACCTAGTATGTAGTATGCGTCAAGGGCGGCGTTTTCTTCTGCCTTTGACGATACTGTATGCCGTATT
GCGATCTTCTCAAGCAGTTTTGCTAACAACTTTGGCAAAGAGTGTCCGATGCGATTCCTATGATCTCGGAGGCCGTGGCTAACGGCAGTCGGCTTGGTCA
TTTTGCGAGGCCAAGTGCATGTACCCACGCAGCTGAAATGGCTTGACTTGAGGATCTTTTGTGGTAGAAATTTTAGATCTTCCCTTCTAATCTGTTTTCT
TGTGAACTTTGATTCCGCCTGTCTCATTATAACCCCAAAAAAAGTGAACTGAAGTTGTGACCCCAGATGTTATTCAGCAGATATTGAAAAAAATAGTTTA
CAGAGAAAAAAGTAAAAAAAGGATGGTATTTTTTGATAGACTTGCCCTCCATTTGCAGTCTACACAACGCCCCCCCACAACATGTAGTAGTGCCACTGAG
TGGACGCCACCATACTGTTCAGTGAACAGTGTTCACCTCACACACGATGCATTTGGCATCCGCATGGCTTCGGTGCGTGTGACATGGTTTTTGCGCCACC
AGATTTTCCGCTCTCGCCTGGACTATGCATTTTATCCTCGCAATTGTAAGGGGCCAGCTCCTTGCTTCTTGAGATGGTGCAGCAGTCTCCATTCCTCACT
AGGAATCCTCAGCCAGTTTAGGTTTCTCCAGGCGAGCGCAGGCCCCCCTCAGGCAGATAGTCCACTTACATTTAGGTATTAGGCACTATACACCCACTCA
GCCATGTCACGCGCCGTTACGGTCTTGTCGGTCGTGGCGTCTGCTGTCTATGCGTCCACCACCACCAAGTCGTACGAGACCAAATCGGGCGTTCTTCCAT
GGGTGGACGTGGATACGCCCAGCAAGGCGAAGACACACCAGTCGTCGCGCGGCGAGACGTGGACGCTCATCATGAGCGACGAGTTCAACAAGGAAGGACG
CAGCTTCGACGCCGGCGAGGACCATCTCTGGACGGCTGTCGACAAGCCCGACGGTGTGAACGCAGCTCTGGAAATCTACTACCCGAATATGACAGGAACA
GCGTGTGACGACGACGGTCACTGCTACTTTTACATTGAATCGGACATCCACGAGACGAACCTCACAGTCTGGAACGAGTACATCTCGCCCCCTGGCTACG
AGGACGTCACGTTTTACTATCGATCTGCTATGGTGCAGGGGTGGAACAAATTCTGTTTCCAAGGAGGCCTCGTCACGGTCCGGGCCCAATTGCCCGGCGC
CGTCACCAACGCTTCCGGTAACCCGGACATTGAAACCGGGTCTACCAGCGTCCGTGCAACTAGTATCGACTACTACCCGACGTGGCCCGGTATCTGGTTG
ATGGGTAACCTCGGTCGCGCCATTTTCACGGGCTCCACGGCTCGAATGTGGCCGTTCTCATACAACGAGTGCAACGATACTATCTTCGACTCGCAGAACC
AACGGATCAGCGCCTGTGACGACGACCCGGGCTCTGGGATGAACCCGAACCAAGGTCGTGGCGCGCCGGAGATTGACATTCTCGAGGGAGGAGGCACAGC
TATCTCGTCGTCGATTCAGGTGGGACCGGGCATGCCCGACGACTTCCGCATGATCGCGGACAACTCGTCGGCGTATTGTTTCTACCGCTATGACTGTACG
ACCCAAGGAGCGAACAACCAGGACGTCCCGACCAAATACTACTTGAACCTACGTGGCCACAAGTCGTGGTACCAGGGACTTCGATACGCCGCCAATAACC
TGTGCGACGTAGAGAGTGAAGACGTCCAGAGCTTCGCCACTATCAACGCGTCGGTGACCAAGGGCATCACGGAGAACGCGTGCACGATGGATTTGTGTCC
AGCGTCGTACGACGTGAACGACTCAAAGACAACGGCTCAGTCCACTGGGGAGTCAACAGCAACGGCACGTGCTTCCCC