Description :
From Genome Similarity Track
Location :
Scaffold_3:1095366- 1096897
Sequence
1531 bases(100 bases per row)
CGAGGCATTCGACCAGTCCTTGCCCAACTGGAGCCACGGCCAAGCGCCCACTGACTCCCTCAACGACCTGCTGCACGAGCCTGGTGGAGCTGACAAACGC
GCCAAGTGCGAATGGATGAAAGGAATCGTCACGGAGTTTGGGATGGACGAGGAGTCGGAGGAGGAGTTCAGCGATGTGGAGGATTTTGAAGAAGAAGACG
AGGAGGAAGGAGACAAGACCGAAGAGAAACAAGAGAATGATGCTGTAGTTGACGACGAAGGCAGTAGCGAGTTGTCCGAGGAGGAGAAGAAGAAGATGCG
AGCGCTAAAGCAGGAGGTGGACGCACAGGAGTCCTATCCTATGGTGAAATGGACGCTCAACCAGCTTCTGCTGCACGAGAAGCTGAGTAAAATTCCTGTC
GAAGAGTGGACACTTCACTCCACTGGAGAAGCAGTCGCTTGCGCGCGTGCCTTAGACGACTCAGAGCTTGTTCTTCGAGCCGTAGAGTCCGTTCTTGCGG
TTCGTCGAGGTGTTAGCGTCGAGGAAGCGCTGGCGCTGCCGTCTGGATCGGAACTTCTGAGCGCTGATCGTCTACTGAAGCTCAAGCTGCACTACGAGAA
GATCCATCGTGAGCTCCATGCTGTGCAGATCTACACGATGAAAGTTCTCTTGCAGATAGCGGAGAGGGAGGGGCTCAACACTGATTTAGATCCGGCTAAA
GTTGTGTTTGGTCCTGCTGGGATCGACGGCGTATGGATAAGCGACAATTTGATTCCTGAAAATGTAGCGACAAAATTCAAGAAGGAGGTGGCGGGGCTGG
AAAATGTGCCGGACGAAGAGAAAGACTGGCACCCGCACTCGGAGAAGCACGTGCTGGACTTGGTCCACCCGTCGCTCTTCTGTTGCGTATTGGGAGAGAC
TGTGAAAGCTGCGAGTGCGCTGGACCCTTCGACGTTCACAACCCCGGCTGACCAAATGCATCGCTTGATGTTCACTGGGTCGGAAATTGTGCAGCAGCCT
CCAGGCTGCAACACGGACTACCAGTGGATCCCCACCGACTTCCAAGTAGCTGAAGGGGGTGAGGCTGGGCAAGACGGGGATATTCGAGTACGCACCTTGT
CGTACATCAACAATTTGCATCCGGAGCAGCACGCGGACTTGTACGATTCGATCGAAGCCATCTTCGCTCATTTTGTTCCGCTCTTCGAGCGCATGCTCAC
CGACCAATCCATGGGGAAACCGCAGTCAACTTTCGACGTTGATATGATCAGCCATGACTCGTGGCGGGTGTTGCCGCGCCGTCCTCGAGTCCCAGACGTC
GTGGAGCTGCCGAAAGAGACTGTACCCATCTCGTTACGTGGTAAAATTGTGCAAGCTATCGTGAAAATCGCCGAGATCATCCTTACGCCTGAGAATCCGC
AGTATAAAAAGAGGGTCGTGGCATATCGAGGGCACGCCAGCAGAGAGAATCGTCGGCACTGGCATCTATTACCTCGCTAGCGACAACATCAAGAGCTCGC
GACTGGCATTCCGCGCGGAGGTGGAAGAGCC