Description :
From Genome Similarity Track
Location :
Scaffold_272:10951- 15539
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_272-snap-gene-0.9Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_272-snap-gene-0.10RCC1 and BTB domain-containing protein

Sequence
4588 bases(100 bases per row)
AAGCAGCCAGTCTCACGTGAGACGAGCTCTCGACCTGACATCGAAGGCGCAGTTGGGTGCCCAACCACTACGCCTGGACAGTCGACGTCTTTCAAACCAG
GACAGACCATCGACGTCCGGTACCACCGTAACAATCACATCGGCGGCTTCATCCGATGGGCCATTGTGCCGCGCGGACAAGAGTCGAAGACCAACTTCGA
CAACAACGTCTTCTACTACACGTGTCGTGAGTCTGGTGCTACTtGTCTTCCTTCGGGGCAGAACGATGTCTACTCTGGTGATAACGGCGCCCCGGAGAAC
AGCATTCTCTGTGGCGACAAGATCAAGTTGCCTGACTGGCTGCCGGCCGGTGACTACGTGTTGCAGTGGACGTGGATGAGTGCCGGTTCAAGTTATGGCC
ACATTTCATGGGCCAACGAACAGTACCGCTCATGTGCGGACATCAAGCTCACGTCTGCTGGCACTGGCAAGAAGCCATCGTGCCCGACGTTCGTGGGTGG
CGACCGCGTGACCAAGCTCAAGGGTAAAACGAGCGACCAGTGCTTCTACTTCCAGAACAATGACATGGTCTCGTCGATCTTTAAGGGCGACGATAGCAAG
CCGGACCAGTACTACAAGTTCGGCAAGCCGGCGCAGGTAGAGAAGTGCAAGGGAGGCTCGGCGCCAGCTCCAGCACCAGCTCCTGCGAAGCCAACCGTCA
CCACCGCCAAGCCCAAGACGTCCAAGCCCAGCACGGGCAACGGCACTGTCCAGCCTGCCGGAAAGAAGGGCGTGTGGGAGTACTGTACCGCTCACAGTGA
GTGCCAGAACGGCTGCTGCTCCGACCAACTCTCCGACGACTACAAGAAGAAGTGCACGCCGGGCGTCTGCCCTGCCCTGAAGCAAGGCAAGAAAGACCAG
TGGGAGTTCTGCACGCGTAGTGATGAGTGCGCGAATCAGTGCTGCTCCAAGCGTCTGTCGGACGATGGCAAGATGAAGTGCACGCCCGGAGGAGCTTGTT
AACGTGGTTTGGCTTCGTTTAGCGTATGTAGCCATTTCAGTGGAGTTCAAAAGCACGGTAAACATCAATTCATTTTTGAATCGTGGGACCCCACGGCTCC
CTGAAAGTTTCCTTGAGGGGGTTCGAATCGTCGCGCGGAAAaCGGCAACATGGGCGGCTCAGATGGCGCTTCTTCAGGGCCTCGACACGCCGTCCTAAGG
GCATTAGCAGCATAAGTGATGGGTCAGAGCGAGAGTGCAGCGCACCCGCGACGTGTGGACCCGCGATGGGCGCGAGTGGCCCTGGAACAGCTGCGCGATG
AGGAGTTCTTGATCAAGCAACTGCGGCGTCAGGAGACAATTGCAGGAGCACGACAAGCGGCCGCCAGTGGTGCTGGACGACGCCAGCGCCGAGGCTTGGG
GCTTTTCACGGATGGCAACACGCACGACCGAGATCGGCCCATGTGGAAACGTATACTCAAGCACAAGGCTGAGAATACGGATGAGGACGGCGAGACGACC
GCGGCCATGACGCAGGAAAAGACGATGACGGCAGAGCAACGCGCACGTATCGAAGAAGTGCAAGAAGACGAGCTGCTGCATACGTTGGTGTTACTAGCGG
ACCTGCCACAGCCGACAAGAGCCGCATACCTGCTCTGTCATCTCCAGGACCAGGTCGCCCGCTATGCCTCCGTGGTGGATCCTGTCGTCGAATTGATCGC
GCTACGTCAACAAATCCTCCGAGACATGTACGAGGCAGTGCATGCACAGCATCAGCACTATAGAACAGCATTGGCAGTGCATCGAAGTGCAGTGGAGATG
GCTAGGGCATCGATGGTGACCAAGAACGAGGACCAAAACGTACCCGACGACACAGCAATTGAAGGTGTGTCTGCTGTGGAGGCCTCGTTGGCTACAAACT
GTGTGGTAGAGATCATCAGTGGGCTCTTGGAAATGGCATCTGTTGAGTCGGCGCAGGACAGACGCGAGCTACTACGGGACATGACGGCACTGATTGAAAC
CTTGCCGCCATTGTCTTTAGCACCGGTGAACACGGCATCGAACCTTCAACAGAGTAACGTCGGCGACTCCGAGGCAAGGCTCGTCGTCAAGAAACTGCAG
CAGTTCCTGTTGAATATAGCTATTGGTGGCGCTCTGAGTTCAGCTAAGACAGAGCGTGTGAAAGGTGATATCTCGCCTCGTGCGCGTTCTGTATTGGTAT
CGGAATATGATCTAGCGGATCGAACGACTGCCGTTACTGCGTTGGTGCATCTCTCGGCTGCCACAGCGGCAGTAGAAGATTTCCTTGCCGTTGTCAGTGT
GCTGCTAGGCGTTGGAATGGGCaGTGACGTCGATGGTAAAAGCCGTGATGCTAACAGAtGATGCATCGTGACCGAATGCCCATCACCGGAAGCGATCGTG
GCGTCTCATTCTCTCGCTTCGTCTCCTGTAGCTGCGACATCACGATCAAAGGATCTCGTGTACCTCAAAGAGTTACAGGAAGACGACACACCCGTAGATG
AGCGATTGGACCCATCAGAAGTCATGTCCACGTATGCAGTTGAGCAGCGTCTGCGGCAAGTCCACAAGCAGCGGGTTGATCACGGTGTTAAGATTGATAT
TGAAGGTCAAGGTACCTGTGTTGACCAGCTACTTACTGGTGGGACCAAGCGGAAGGCAACGAAGAACCTCATAGCAAACCAGAACAAAGCTGTCGCAACT
GGTGCAGGCATCTCCAGTAGCTCTATTGCGAATCGAGTCTCGGTACCCCAGATCCCTATTGCTCAGGCCTACTCCTTGAACGGCAAACAGGCCATTAAGG
GGCCCAAAGATGATTTCAACAACGTGGCAGGAGACGTTGCATTGGGGTTTTCGTTAGACTTCGCGTCCATTCGAAACGATTCTGGAACGTACTCACCACG
ACACGAGATACCAAATTCAACTGCAGCGTTTCAGTGTCCAAAGTTCCAGTTGCTGAATGTCAGCACTGTGTTGAAGGGATTGGATGAGATCAAGCCGACT
CCACCCGCGCGTCAGTCTACGCTACGACTCCATAATGGACACTTGGATGTTTCTGTCCCAAACACCGCGAATCATGAAGGCGAGAATATGGAGGATGACC
GAGAAGTATGGAGCTGTGGCCAAAACTCGTACGGAGAGCTGGGGCACGGGGATACAACAACACGCAAGTCATTCGAACGAATTGACGCCCTTCTACACAA
GGATATCGTCCAAGTTTGTGCTGGAAACGAGCACAGTATCGTCCTCGGTGCAAATGGAACGGTGTGGACATGCGGATACAACGACAATGGTCAATGTGGT
CATGGTGTGACTACAAGAATTAATCAACTGACCGAATTGCAGAAGCTGATCGATTCCCCAATCGCTCAAGTTCATGCATATAACGGATGTGAGCATACGA
TACTGGTATCGCGTGACGGTCGTGCTGCCACGTTCGGGTACAATTATCGTGGCCAGTTAGGGCATGGTAATACACAAAGCGAGACGATACCGAAGATTGT
GCGGAGTCTCGAAGGCAAACATGTTCGCATGGTGTCGTGCAGCTACTATCACACGATCCTGACATGTGAAGCTGTGGCAAGTGGTCAAAGTTTGGTGTAC
ACATTCGGACGGAATGACTATGGACAGTTGGGGCATGGAGATTCGATCGATCGAAAGGTTCCACAACACATCGAGGCACTTCAAGACCATCAAGTCGTCT
CAGTTGCATGCGGACAATACCACACCATGATTGTGACTTCGACTGGAAAAGTGTTCGCTTTCGGGAAGAACGATTATGGGCAACTTGGCGTCGACACTAT
TGAGAACCAATTAGTACCAGTTCAGGTCAAGCACACTTTAGAACGGCAAGTCGCTCTAGAGGTTCGATGTGGCTACTACCACACAATTCTTCTCACGGCG
GGGGCGCATTTATATGGGTTTGGCCGAAATGATTATGGCCAGCTCGGCCTCGGCAAAGTTTCCTACTCCTCAACACAAAACATACAGCTCCAACAGCAGC
GGTTTGCATTTCCGCAGCTGATTGAAGATCTCGAAGGAAAAGAAATCGTGCGGTTTGCATGTGGTTGTTATCACACGATTACTGTGTCGGACAACGGTGT
CCTCTACGTATTTGGACGAAACAACCATGGTCAGCTGGGGACAGGTGACACAAACGAACGACTATATCCCTACCCAATAGATGACTTTGTCGGGAAGCGA
GTTGCAATGGTCGCAGCGGGATTTTATCATTCGCTAGTACTCACTGGAGGAAGAGACGATGAAGGTGAAGATGTCGAGAACCAAGAGCGAGGTGGTCATG
CTGGCGAACGAGATGCGACCAGCGACGGGACCGAAAACCTACAGTCTGCCCATCCGACGACTCTTATCAGCAGCTCTGCGATTTTGTCAAGTTCGGCAGT
GAAAGAGATTCTCGACGGGAAATCGCACTGCGTAAATCTTCTtACTGTGCCACTGCGGCCAAAACCTCGTGAGCCAAGCGAGAATACTGATCCAACAAGT
GATGCAGATGGCGAAGATGGTCGAAGCGAAGACGGACAATCTCATGCTCACAGTGACTGGACAGGAGAGAACATTTTTGACCTCACGT