Description :
From Genome Similarity Track
Location :
Scaffold_228:10951- 38843
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_228-fgenesh-gene-0.2Sulfotransferase
Pytir_DAOMBR486maker-pir_contig_228-fgenesh-gene-0.3Transmembrane protein

Sequence
27892 bases(100 bases per row)
TACCACTTGAAGCGCCGACCGACGAGCTCAAAGAGCTGCTCGTTGAACGGCGCGTAGAACTCGCGCAGCCGGCGCTCGATCGCGGGTTCGATCGGGTCGT
ACGCGCGCGTGTTCTTGCGCTCCGTGTCCGCTACCTGGTGAGGCGGCAGGTCTAGGAACTCGAACGCGCGGCTCGCTTCGCGCTGCGTGCCTTCAGCGTT
CTTCATGTCGTCCAGGTCAATGATCAGCATCTGGTCGCGAGGGAACACGCGCAGCCAGAGCGCGATCTGCAGCGCGTACAGCCCGCGACCTACGTACGAG
TGCGCCCCGTGCTGCTGCGAGAGCGCGTCCACGTACCGCTGGAAGCTGTTGAGTACCGCGTCGTTGCCGTCGAGCAGGGACGCGGACGTCACATTTGCAT
CTCCAAGGAGCTTTAGGTCTTCGTCCACGATCTGCTCGAACGACTTGCCCTTCACTGCCTGACGCATGCGCAGCTGTGTGGGCGTGCCATTCGGGTCCGC
GGTCATCTGGAAGTGCGAGAATGCGCGCTTCGCGGGGTTGCGCAGCATCACGAGCAGCTTGATGTCTGGGTACAGCTACGCCATGCACGCCACAAACCAC
AGAGAAAGGCTGTTCATGAATTCTGACAATACGTGGTGGATACGACAACAAAACACGATTCTCAAACCCACCAGCTTCAAGCGCTTTGCGACCGGCTCGC
CATAGAGCAAGTAGCTGGGCGTGGACTCGCCGATCTGGAACGGCGGCTGGAGCTCTTCGCCGCGCTCGCACTGCAGCGAGAGCAGGTACTTGATTCTACA
CAGTTGATCGATCGAGCATCAGTCATTAGCGCCATCTACTCACCCTTTCAAACAGTTTAACTACTACCGCCACTCACCTCATGTCATCGAGCGAGTTACC
CTCCAGAGCAATGCTGCGACTGTCGTCCTCATCCTCACCACCGGCTGGCGAGAAGCGTTGGAGCACCTTTTCGTACTTGGCACGCTCCTCCGGCGTGAGC
TTGTGCTTGAGCGCTGCCTGCCACGCCCAGTCGAAGAAATGCGGCTCGCGGCGCTTGCCTTTCATCGCCTGCGGGTGCTGGCTCAGGTAGTCGTAGAGCG
ACGTCGTGCCACACTTCTGCGAGCCGATGATGACCCAGTTTGGCGCAAAGAGCTTCCTCACGCGCGCGCGCTCCAGCTCGTCGCACATGCGCACGTCCAC
CAGCTTAAACATCTCGAGCAGCTTCTTCCAGAGCAGTTCGGCGAAACTCTGGTCTGCGGAACTAGCACTATCGGTGAGCAGCACGTTCTTCTCGACCGCC
TTGACAAACTGCTTGCCGTTGATCTGCTCGATGAAAAAGTGGCGGCACGCGGTCGTGAGCGCCGCGCCGGCGTCTGCGTTAATTTGCTCCTTGACGAGCT
TCTCGATCTCGATCAGCTGCTTGCCCGCGAGCTTCTTGCTCTTCGTCTCCGCCTGCACATCCACCTGGTCTACGAGCTCAACGCGTCCGCGTACCTGGCG
GCACATCTGCCCCGCCGGAAGCACCACCTTGGTCTTGATCTCGTGGTGCTTCTCCACGTAGTCGAAGATGAGGTGGATGCGGCGGTGCGCCGTCGGGTTG
TGCACGCAGTGCTTCGCCGCGTTGTTGAGCTCCACGATCGTGCCTTCGTTGAACGCGAACCGGGTCATCGAGTCTTCCAAAGGTCCGCTAGAGAACGCCA
CCTAGTTTGTTATACATACAAAAAGCGAAGTGAGAAGATACAGAGGCATGTTGGTGAGGACGGATGGTGCGGCCTGCAGATTCATTGGAGGAACCCACCT
CTGGGAACGTGACGATCGGCACGTGGATGCGGTGGGTCTTGCTCACCCACGGACTAATTGATCACAGCAAACGCACACGTTGATACCCACGAGCATGTCC
AAGTAGCCAAACACCAACGCCAACGTACCCGTTATCGTGGTGCGCGGGGATGAGTGTGTCGCCCGGCATGCGCGCGAATAGACAGCGAACGACCTGCCAT
CAGCACAAACCACCATCATCAACTGCACACCTCACTCACTACACAGGGTGCGCGACTGTACCCCATCCACACACTTTGATTGCCCACATACGTACATACC
TGGTCGGGATGCACGTCCATGCTCTGGAAGATGCGCTCCAGGTGGTCCTTGTAGAGCGCGTAGAGCGGCAGCTCGTAGACATGCTCGAGCTGTGTGTCGG
AGAAGACACACATGATGTTCTCGACGCCCAGCTTGTCGTGGAACGGCCGCTGGAAGTACACATTGTGCTCGCGGTTGTAACGCTCCGCCCAATGAATCTC
GGGAAGCGCAGCGAGCTGCGCGCGCAGCGGAGCGATGTCCACATCGCCCACGAGCGCCGCGTAGAGCAGCGTGGCGTGGTCGCTCGGCGCGCGCATCTCG
GTCGGCACGCGCTTGTGCGACAGCGGGATGCACGCGTGGCGCGGCGGGTCTGGCGCGTTCTGACGCTGTTGCGGCTGCGAAGAGGAAGAAGATGGCGCCA
TGGAGACAGACGGACGAACAGGAGGGAGCTGCTGAGCTTGGGCTGGCTTGGCGAGCGCGTGGCGTCGTGATTGATGGATGGATTGATTGATTGATGGCCA
ATGCGTCCGTCAGCAATTCTGATGTGGGCTTGACACGCACTCAGCAAAACCTATCTAACAGAGTAGTCTATTTACCAGTTCCATAACAACTCCAGCGTCC
AGACTATTTACATGAAATAGTCTATTCGCAAGGTCAAGACAGTGGTTTCATCTGATAAGTAGTAATGGCTACACTACATTGTGGTGAACAGTTAGTTCAT
GCCATCACAGTGCTCTCAGAGCTTCTTGGGCGTCGCTGGCTTGCGAAGCCCGCTTGCCTTGCTCGTGGCGCCAGCAGCCGCCCCCCTGGCCAAGTTCTTC
TTGAGCACCTTCTCGAGACTGCTCTTCGCTGCCGCAGTTGCTGGTTTCTTCTCGGGGAGCTGCGGCCGAAGGTATTTCGCTTCACTCGGAGTTACTTCTT
CAGTTTCAGCAGCCTCTTTGCCCTCCAGTGGCTTGCTGGTACTGCCGTCTGTGGACGCGTCCGCTTTGGCCTCCGCCTGCTTCTTCTTCTGCAGGATGTT
CTCCATGATTTTGCTCTTCCCAGCGCTCGGCGCCTGCTTGTTGAGCAGCATGTACGTACCGAACGGCTTTGGCTCTTCCAATTTCTCCTCATCTCTGTCT
CCGTCGTCTTCATCTTCATCATCCGCGCCTTGCTCCTTCTGCTCTTTCTCGCATTGGATCCGATGAGCCTCTTGTGTCTCCTTCACGTCATCCTCGTCAC
CATCCGGTGCCGCTGTTTGCACTCCCACTCCCTCGTTTTGAGGCGCTGATGGATCGTGCACCTGCTTTTCAGGATCCTCATCTGGTGCCTTCCGTTTAGA
AACCTCTGTAGGTTCCAGAGCGGCAGTCTCACTTTGTGGGGACGCATCCACAGCATCTTGGGAAGCCGCGACTTCTTTTGATTTCGTTGCTGCGCTTTCA
ATCTCGCCAGGGTTCGCCTCTTCTTTTGCGCTCGAGCTAACAGCAATATCTGGTAATGGTGATCCACTGGACTCCTCTGAAGAAACCAGACGCTGAGAAT
TGCTGACTTGAGGCGGAGGTGTCGTCACGTCATCCACTATCGAGCGCTTCTCTGGGCTCTGCGACTCAATACGAGCATTCTGAGCCACCTCTGGCTTGTG
CGTCACTTCACTGTCTTCCTCTGCCACAGGAGCAATGGGCGCTTCAACTGCTTGAACGCCCTTATCACCTGCATGTGACGACGACCAACCTCGTGGTGAC
GGCATTTTCCAGTTTTGCATTATTGTTTTGGCTCTCTGCGTGGGCGGTTGCGCCTTCGAGGACAACAATTTTGACACCTTGTTCGTCACCCCTCCTGGTT
CTCCAGTAACCCCTGCTGCCACCGCCTTGCCTCGGTCGTCTCGGTGCTTCTTCTTCAGCACCATCTCCAACGCACGCTTCTTTGGTGATAGCTTCCGATT
CTGGAGGATCACGTACGCGCCTGTAGGTGGCGCTTCGTCTGCGCTCCCGCTAGCAAGTACATTCTGCTCGGAGATGTCGTCGAGACTCAGCTCGTCCTTC
TTGCCTTTCGCTTTACTGCTAGCAGAGCTGTCAGTTGCTGCTGCTGGTGGTAGTAAATTAGTCTCTGAGGACTTGCCGCGCTGCAGAATGGGCGGGAGTT
TCCCGACTTTGCTCATGAGCTTGTAGCTCAGCGACTCGCGCTTCTCCTTGAGCTCGCGCAACAGATTCTGACGTTTGACGAAGATCTTGGACTGCGGGTC
GGCGGCCGGACCGAAGCGCGCCGACGAGCTCACAAACTTTTCCTTGCCGCCTCGTGCTTTCTGTTTCGCAGCAGCATCCGCATCTGTCTGGGCTGCCAGA
GCCTGAGCCTGCTGCTCTTCCTGGTGGTGCATGCGCACGCAGTGCATGCCGTAGAGAAAGTGCTCAAAGTCGACGAGGTCTGCATACGCCGGATCCAGGT
CGTAAAGGAACTTGAACACACGGTCGGAAGACACGCGCACGCCCAGCTGGTAGATCGACTGCGAGATCACCGTATGCGACACGAGGCCGAGCTTCGCCGG
ATCCGCGTCCTGGAAGATGATGCTGAACGCTCGAATCTCTTCCTCCATGAAGCCCTCGATCGCCTTCCTCACTGCCAGTCGGCGCTGCTCGGCGAGCGTG
CGGTGGGATTCTTGGCGCCGCTCGCGGACCAGCTGCAAGTACCGACAGCGCATCACCCGCGTAAGCAATCTGCGCTGGATGCGCACTGCCGCGTTGAACC
GAATGCGCTCGTAGAGACTCAGCGACGCGTAGTACCTCGCCGCCGCTGTGGCCGCGTCTGGCTTGATGCGCAACGCCTCACGTCCGTAGCGAACGAGACG
GACGAGCCACGTGTCCGACCACCACGCGCCGAGTGTCGACCAGACGATCTGTGCAAAGATCACGCCCGGCTCGACGATCAGGAAATGGAAGCCCAGGCCA
ACGCACCAGCAAATGACGCATCGCCACGCGGTGGGTTTTCCCAGCTCCATTGAACTACGGACGACCAGATAAGCCATGACCCCGATCCAAACTCCACACA
ACGCAAAGGTCACGTACACGATGGACGCAGGGTACGGCACACTCGCGATCCCTTCATGATGGCCAGTAGACTCGTCTTCAAGGGACATGCGTACCCCTCG
GTTTGCTGATAGTGACCTCCTTCTCTGCGGTGGGAGAACAGTGTCTATCAACGCACTCGAACTCGCCAGTTTCGAGGCACTCGACACTGCTGGCGATGCA
GACGACACAGTAGAATACCTCATCTGGGTATCTTTCGGCGCGACAATCAAAGGCGCGACCGCCAGCTCGGACGCGATGCTGGGAGCGACGCTGTTCAGAC
TCGACGAGAGCATCTTGGAGAGGATCTTGCCCCTCGCCGGCGCCGCGATCTTGAGCCCCACGACCTTTTCGAACGTCTGGCGCACGTCCGCCTTGCGCTC
GTCGTTCACGCGCAGTTTGAGCTTCGAGTCCTTCGAGATCACCACGTCGTATGCAAGGAACACGGCACTCACGCTCAGCAGAAACTGTGCCGAGCAGATG
CCGATTGCAAAGTACGCGGCCGTGTCGGCGATTCTGTGGAACAGCTCGAGCATCTTCGGCAGACAGCCGTTCAGGTCGCGTATCTCGGTCTCCTCCTTCG
TGATTGCAGTCCCGTTCACGCTCTGCGCTTTGTACTCGACCTGGACGCTCGTACCGGTGGGACACGGCCGGTAGGCATTGTCGCTTGCGCTGCGGAAGCC
ACAGCACTGGAGATCCTGCTGCACGCGGTTGCGGAAATACGTGGATGTCTCCGAGTTCCACGCGCTCTCGAGCCGCTTCACAACGCTGAAGCCGGTCTTC
CGCACCGTCCAGTTGTCGACACTGGAGGACGGGTCCGCGACAGCGGTCACTTCGTAAACCATGTAGACCCCTAAGAGCGCACATACCATGAGCAGCAGCG
ACGCGATCGCGACGGCGATAAACACGACGTGGCTGCCGCCGCGCTTGCAGTTCTTCATGTCAATCGCGATCCATGCAAGCAGCGACACTAGCCCGATCAG
TAAACTCAGGATGAGCAGCTCTCTCGGTCCCTGGTCGATCTTCACGCCGTACAAAGTGTCGCTGTACCCGATGAGCACGAGCCCCATGAGCGTGCCAATG
CCGCACGCGAGTAGGAATAAACACGCGGCGACAACGTGAAAGAGTCGATAGACGAACCGCGACAGCCACGTGAACCAGCGCTCCTCAGTCGTTGAGTGAG
ACGTGTCCATCGTGGACGGCGCGAAGCTATCCGAGCCCCCCACGACGCTGCTCGAGACGCCCACCTTGCCGCTTTGAGGGTGGAGATCTGTCCTTGAAGG
TGAGGAACTAGCTCCGGCGCCAGCGCTGTGCTTGGGGCGGCGTCGCTGAAAGAGGCTTCGAAAGAGCAGCACTTTCTCCTTCCGCTGTCTTGCGTTCGCG
ATCTCGGAGGTCTCATCATCACAACGGTGACGGATGAGCTCAAAGAGGAACCGACAGCCGCACTGCGCGGCGTAACCCGCGAGCCCGCCGTAGACGACCC
CCATACCCAGCACGGCCCACATGTCTGGCTGCTCGCAGGTCTTGAGCGATTTCCGATGGCAACCCTTTGTGGCAAAGTAGCCCGTGTAGACCGCCAGCGT
CGTCAGCACTGCGCACAGGATGGAGCACAGACGCTGCCCGCGCGTAAACTTTGGGTCGTAGTAAAACAGCGAGAGCGCCAGATGGCGCCTTCGTACTTCG
CTCCTATATTTGCCCACGGCGTAGCGCACACGGCTCTCGATCACGAACCACTCTTCCTGCTTGGTGCGCTTGAGCTGCTTGAGCAGAAGCACCCCTAGCC
ACAGCAACAAAGTCTCAGCCACAGCGAGGCACAATAAATACACAAAGAGCCACCTGAAGGACAAGCTGATCTGCGCCACGAGCACGTGCTGACAGCCTCG
TGCGCTTGAGAGCGGACACGTGAACCCGATCGCCGGTCGGTCAAACACGATACCTTTGCCTTTCACAACCGTGGGGTCGTTGAACCCGCAGCACTGGTAG
TCGAGCGAGATCAGGTGCTGCGTGTGAGGCATGAGCGTATTCCACTGGCGGTCCAGGAAGGAACTCAGCTGGTCTTGCCAGTTCTTCTCACCAGAGAAAC
GCGAGAGGTAGCCCGTCAGCCCCACACACACCCATAGCGAGAGCGCGAAGATACCTCTTCCTACGGACTGGAAGAAGATTTGGTGCACGACGCTGTTCGT
CGCCGCATAGAGCGAGTAAAAGTTCACGCCGAGACCGAAAAGCGCGTACACAAGCAGCGCGATTCCGATCGAGAACGCGAAGAGCAGCTGCAGCAGACTC
GAGCTGAAGATCGACCAGCGCGCGATGAGGTCGATGGCGATGAACAGCGTGTTCAGCGACGCGAAGATCGAGCCAAAGGAGAGCAAGAGTAGTCCCGTGC
GTGCGAACTTCGTGACCCAGCTTTGCTTCCAGGAAGGTTTCTTGCCCTGCCGCAGGAACAACACGCTGGCACTCGCCAACATCACCACGAGGAACGCCAG
CAGCGCGATGCAGATCTGGGACGAGTAATTGGCGACGTGCACCAAATATTTTTTCATCACGGTCGAGCAACCGATGTCGGCACCTGGTGGACAAACTGGT
TTTGTGAACGTCTGGGCCTGCGTCTCTGTGAGCACTCGCCGGGTTGTCGTCCTTGTTGTCGTCGACAAGTCGGAGGATGGTCCACTTGACTGAAGTGATC
GTGTGTAGGAATGCGCAGTCGTGGGAATATCCACTTGGGCCCAGAACGTCGCGTCCGCCATGTCTGTGAATCCCGTCGTCCCATTCGCGGCCACAGTCTT
CTCATACCCACAACAAGTGAACGCGTTCTGCACAAACACTTTGGTCGTGGACGCCGCGCCTTTCCAGAGCTCTTCGAGGCGGAAATTCGTCGCGTCTGAG
GTGAGCGTCGTGTGTGCAAACCGGTACGAAACACCGAGAGCCCCGAAGGTGGACGCAAACAGCGCTAGCCCCGTTACAAAATACACGATGAACACCTTGC
GCGATCGCTTCCACGCGACCGTGAAGCCTATGCACGCAAAGAGCTTGAGCCCACCGCCTAGCACTACGAGGTGCACGCCGATCCGCCGGTCGAATGTCTG
CAATAAGTACGAGACGTGCAACACGTTGAGCTGGTAGATCGCGTCTATGCCTGACCAGAGCACGATGAGCCCCAGCACCGACGCCACCACATTGAACGAC
ACGAGCACAAAGAGACACGCGTTGTGCACAAAGATGTCGAGCGCGGTCGTCTGATACTCGTCAGGTTCAACTGGTGGCACGACAATCAAGCCAGAGGGGT
GAATACTGGGCGTGCCAGCAAAGCGTCGAAGGCGCATCAGCAGCACCACCGAAAGCACAAACACGACGGCCTCGGCGGCTACGAAGACGATGACACGTGT
ATTGAACACCGCGATGCCGCTCACGAGGATCTGCTCCACGATCGAGCGGCACGTCCGGATTTCTTGGTGGTCCTCACTATTAGTGGATGATACGCAAGTG
CCTTCCGAGGTTGCGTCGAACCCGCAGCACTCCATTGCGACCTCGAGCTTCACCAACGTGTTCCGAGGCAGCGAGAGATACCGGGACTCGGTCTTCTGCA
TCAGCACAGGATCGGTCAAAAGGTTGTCTCCAATACCCCAGAAGAACTGCGAGATCCCGAACGACACGACTAGGAATGCCAGTGAGAGCGCCACGAACCA
CTGGAGACCACGTATATCACGATACGTGAGCGCGTGGATGCCACGCAGCAGGATCGTCAGGTACACGGCCGCAGCGGCGATCACAACGCCGCCGATTTCA
ACCCCGTACAGCGCCGAGACCACGGCGTTGGATACATAGTTGAGCTGGATAACCATGTCGACGCCGTAGAAGACCGCAAACACGACCACGCAGCTCAGCA
AGTAGCACAGCGACGGCAACGTGCAGAGCAGCATGACGTTCCACGACGAGCTCAGCATCACGCGCTTCGATGACGTTTCCCCATTCACAGACGATGCTGG
CTCACCCGCGAGCTGCTGGAGTCGCAGGTGACGCCATTTCACGAGGGTGTTGGCAAGCGTGATGCAAACCGCTTCAACCAGGAATAGGAGCTCCAGGTAC
ACGAACGAGTTCGCGAAAACTTCCTGCGCCTGATGCGTGAGCACGTGCGAGCAGGTGCGAGGCGGCACTGCGTCCAGAGCTTCCTCTGGACACGCGCTCG
CCTCTTTGATCGAGAAGAAGCCGCAGCAGCCGTAGAAGCTCTCTACTTCCTCTTTTACTTCGGCGCTAAGCGCTGCCCACGTCTCTCCAAGTGTGGAGAA
CAACCCGCTGGGCATGCTGCTGAGATCGTTCAGGTACTTGAACGCGATCGTAGCAAATGCCAATTGCGCGATGAGCAAGAGCGAGAGCAGCGACAGGTAC
GTGTTGCGCGAGGTGTGCGTTGCGGTTTTGCGAGCGACAACCAGCCCAAAGAGACCTGCAGCGACCAGCATCCCTCCGAACATGATGAGCACGAGCCCAA
GGGGTTTACCGTAGACGTAGAGCAGCAACTCCGACGTGCTGTTGCCCAGTACCAAATGGAAGTCGATCCCGATGAAAGCCAGGATCACGCCGACAATGAC
CACAACCACGTCGCAGAATCGAAAGCAGCCGAGCACGAACGCGTACTGCGCCTCCAGCGTCTTGTTCGCGCCGAAGAGCGTCCTTGCTTCATTAGGGAGC
ACAACATTCGGGTCGATAGTGGAACTGGCGGTCACCACGTCTGCTATCAAAGCTGTACTTTGAGTATCTAGGACGCCACCGCCAGGCGTGATGCTTGACG
CTGCGGTGGTCGCATCGGTAACCCCACTTTGCTCCGCGAGTCTGTGGCTCACCTCAGCAGCAGCCTCAGTAGCCTTTTCAAGCTTCTTTCGGGCGTAGAA
AGTCGTAAAGTCCTCTAGAACCGCGGGATTTTGGGTGGTGCGCTCCTGGAGCTCTCCCCACTTGGCTCGGTTCAGGTTCTTGATCGTCTTCTCCTTGTGC
GTCTTCTCGTCCGCTGAGTCCATTCGCTGGCCGACGCGACTCCCGAGAATGAACATCCAGAAGAGAATCGCGGCCGTCACACTTGGCACAATCGATGTCG
GCTCGTTCCGATACAGGTCCTTGTAGAGTGCGTAGTAGTCCAGTCGCTCCTCCAGCGTGACCAGCACTTCGAGTTTCGCAATCTCGCTGCAGTAGCACAC
TGTGATCGCTGGTGTGCTCGTGGTGTCGTCCTTAAAGCAGATCTCAGGGTCCCACGCTGAACTTTGCGCGTTCCACACCTGACACGCCGTCGTGAAGTTC
CGCTGCTCTATTGCAGAGAGCGGACGAAGGTGTGGGATCGAAAGTGCGATTAGTGGGTACCACACTGTGGCGGCGGCATCTAGACCACTAGTAGAAGCAG
CGAGCCTTCGCGTCGTACTTGATGCGATCTCTGCGCTGGTCGTCTTTGCCGCCGCCTGCGCCACACACAAGCTCGCACTCGACAGTGTTTGAACCTTGAC
ACTGGCGGTGGAACCCGAGAGCGCGGCGTTCAGAGCCGCTCTCGAGTGGATAGCAAACACGGTGCTTGCTGAGAGTTGCTTCGCGTCTCGTAATGAACAC
ATAGAGTGTGGAGGGTTCGAGAGCACGAACGCGCTCAGAAAGAGCTCCGGCTCGAGACATGCGGTCGCGGGCTCTGTCAACCGCACGGATAGCCCGCTTG
GGGACGTGAAGCTTGTCCCCGCTGACGCGAGCGCTTGGATCTGAGTGGACGAGACGATGATCGCGTCTTCATCTGGCAGAGCATCCTGGCTCGCGATAGC
AGTCAGAGAGAGCAGCGTGCCGATCATGTTTCCGAACGTGGCTTTCGCCGTATCACTCTCAGGCTGAATGTTGTTACAGTCGACAATAGTTGCCACTGAG
GAAGCCAGACGACGACCATTAATTCCGGCAGAACTCATGCTACTAGAAGCAGGTGAACTAGTAGTGCCCGAGTCTGAGGAAGCAATAGAAACAACCGTCG
AGAGCGAGTCCACCACGGTTTTCCCAGCAGAATCCAGGAATCCGCTTTGGTCCTGCAGCCCGAACGCATTCTCAACAATGTCAGTGCTCAGCGCCGCCAC
CTGGGCGAGTCCGTCCTGGTTGAACGCTGCTGGGGACGACTGGATAATCGTGTCCATGACTAGCGCCTGTTGCGAGAGCGCCGAAACCGTTGGCTCGACG
ATCCGGGACGACACATCCAGGTTCGAGAGGATCGCGGTGTTGAGCGAACGTACGGCGCTCACGTCGAACTCGCAGTTCACCCCGAGGTGCGCGTCCGAGC
AGACGCACTTAAGCGTGTCTAGGTCGCACACGCCGTGGTTCGAACAGACCACTACGTCGGAGGATGAACAGAAACTCGTGTCGTTGGAGCCGGTCGTGTA
CGCACCTTCGAGGATCGACGCCGCCGAGAGCAGGAACTTGGACCGCTGCGAGACATCGGACGCGTTCGGAGCTCCACTGTCAAGACTCAACATACTGTTG
ACAAAGCGCAGCGGATCGGACTTCGCCTCGGGAGGTAGCAACACCTCGATGGACTCGCTGTCGAACGCAAATCCGCCAAGAGCATCGCTAATGAACGCGA
CAACCGTGATGTTCTCGCTGGCCTTCAAGCCCGCGGGCGGCAACATCGTCACGATCGCTTTCGGGAGCAGCTGGTCCGATACAAATGGGACTGTCTTCAT
TTTCAACAGCGCTCCGAGGTTGCTGCTGACATTCAAAGAGGTAGAAGCCACCAGCGCGTCAAATTCAGACGTCGTGATCACGCCGAACGAGTACTTCAGC
GGCAGATCTTCAGTGTCGTCTGTCCATTCTGCGCATGACAGAGAGAACGAATCCTGGACAGCGTAGCCTGATTTTGGAGTCACTTCAAAGCGGCCTGAGC
TTGGCGGCGAGTTCACTTTGATGGCGACGGACCCAACGCCCTGGTTCCCGTTCACGTCGGTCGCGATCAAGTGGAAGACATACGTCAGTCCAGGCGTGAG
TTTGTTCTTGAGGATCGCGTTGTTGAGACTGGTCAGCGGTAGTGCGAACGCGTCATTCGTGGCGGTGGTCACGTTTGTGTCGATTGTGTTGTCGGGTAGT
ACCAGGTCGCCCTGGGCTTGCACCCAGCGCGCCGTATACGGATATGTCGACTTAACTTGGGCTGATAAGGTGACTCGGCTTGACGCGAGGATCTTCGCTG
ACGAAGCAGCGACATTCACCTCGGGGACACTACCTGGTAGCGTCCACACCGTCGTGGACGTATTCGAAGTCCTGGTTGTACCCGTTGACGAGGTTTTGGA
CACCGTCATTGTGAAGACGAGCGTCCGGTTCTGCTGCAGACTGAACGGCGCGAGAGTCAGCAACGCTCCCTTTGAAGACGATGATAAGTCCAGAGGAACG
AGCCTGTCGACGGAGGATGCTGACGCGTTGACACACGACTGCGGCTGAGCAAGCGACGCATTCGTGAGATCTGCACACGCCCACTTGAACGCAAACGGAG
ACAGCGACAGATCTGGATCAAATGACGACATTCCGTTGAGAACCAGCGCGTCCCGTTCTCCGATCGCTCGACTCCCGCCAGTGATCGCCGCGATCAATGA
ACTGCTCGAGACGTTCACTGTGATCACCGCCGAGCTATTGGATGCTTTCGGGTTGTTGACCATGTACGCTTCGACGCGGAAGCGGTAGGACTTTTCAGCG
TCCAGCGCTGTGCGAGCGATGCGGAACACGCGCGGGTCCTTTGCGATATTCGACCGCTTGAGATCTACGAATGTGTACACTGAAGTACTCCCAAGTATTG
CGCTTGACGCGGACCAGACGTACCCGACCTTGCTACCGGTCTGATCCAAGCAACTCACCGCCGAGTCGACCTGAAGAGTGATTGGATCGCCCACGCGAGT
CGCCTCCAGATATTGATCGCCAACGACGAACACGGACAGACCGGAAAGACTGCGGACCTGGACGTCTTTCATCAGCACTGACTGCTGAGCGAACGCGTTC
GTGAGCTCCAGGCCAACAGAGTACCCCACACCAGGCTCCAGCAACGTGCTGTCAACCAAGATCTTGAACGATAGCGACGTTGTCGCGCTTTGTGCTAGTG
ATCGCAGGTAGCACGCAGATCGAAGCTGCGCCATGGTGGACACGAAACCGAGCTCCGGGTTCGCAGTCAAGTCTGCCTTTGGGACAAACACGGAGCTCGA
CTTGCCGCTCTTCCAGTCCGCGACGTACTTACCGCAGAGTTGACTCAAACTGGTGTACAGCAGCTTGGTCCTCGCCAGACTCACTTCAGCCCTCCCGAGC
GAACTCGCCAGAAGGAACGTCTTTGGCAGCATGAACCAGTACATCTGGGTAAACGGACGCCCGCCAGCTCCCTGCGAGAGTGACGCGTCCACTGACCAAA
TCCCACAGCTACTGGCATCGTCTGGGGATATGAGTACCACTTTCGGCCTGACAATGTCGCTTGGTACCTGCACCACGACGCTCGCCTGTGTGTACGACCG
ACTGGTGCTGCGCGCTCGAACCACGTTGAGCGACTGGCAGATCTGGTTGGCAAACACCGCGCAGTCGTTGAGCAGCAGCGTGTCGTTGACCGTGATCGTC
GCCCCCGAGCCCAGATCCACGCGCAGGTTCTTGAGATCGAGCCATTGGCAAGTCGCACTCCTGCCGAGCGAGTACTTGGACGCCGCAAAGTTAAACACCA
GGTTGCACGAGAACTGCTTCAGCTTGATCGAATACAGAGAGCTCAAGGCAAGCGTCGACGCACTTGCCTGACCCAGGTCGGTGCGCACGGCCATCGTCGC
GGCGTGGTATACGATGGAGTCGAACGCCACCTGCAGCTTGGAGCCCGAGGTGCCGAACGTCGCGGAAATCAGGACTGGAGGCGGGATCGCCTCCTTGTCG
TTCACCATGACCTTGACGCTCGTCACGCCAATCGAGCTGTTCGAGATGTTGTACTTTGCGTCCACGCTGGAGACCTCGTGCAGGATCGACGAGTATTGCG
TTGGGCCCTCGGTGATCTTGTCGTCGATGGCAAACACGGTGACCACCCGTGGGAGGAACCAGTCGAGCGCCGTGAACACAAGCTGAATGTCACGCACTAC
ACTAGAGGATCCTGCGATAACAGACGACGTCGTACCATACGCCAAGCCTACTTGAGCAGCGTGAACCACAGAGTTGTCGTTCAGATCCACGATATCCTCT
ACCATCGGTCGCACCACCAAATGCACGTCTTCGTAGGGCTCGGAATTAAGAAAGATCCGATACGAGTCGTTGAAGCCACCTTCTGCGACGTGAAGTTGAC
TCCGGTTCGCATTCCCGGCCACCAGCAGAGAAATGATAACGTACGCGACGTCATTGTCCGCGATGAGCAGCTCCAGACTGCCATTGCGGCTCGAGTAGTC
TGATACCTGGTACAGCAGGTCTTTGCTCGTGGTCGAGTGCGTGATCAACGCTTCGTGTACTGGCGACTCCACTAACCAGTCGTCAAACGCTAGGAACGAC
ACGTTCTGCCAGACGCTCCAGTTGCCAGCTCCAAAGTACAGCTTTGGGCTCAGAATCGTCGCATTGCAGAGCGTCTCGGATGACAACGTGCGCACGTAGC
ACCCGTGATTCGCGCTGGGCAACACCACGACCGGCTGCCATGGCTCGGTGTTCAGGCGCACGCCGTATGTATACACAGTGTGATTGCTCTCCGAGACGTT
GAGAAGATGCGTGGAGAGCGACATCCCCGAGACGTCATTATCCGTAATGTGCACGTTGACGCTCGCGAGATCCTTGAGGTTGGCGTAGATGAGGTCGTTC
GAGTGGACCGCGTGTACCAGGACGCTTGATGAGTCCTTGACGTCTTCTGTGAAATCGTCCAAAGCGTCCACACGGACAGTCTGGCTGACGTTCCAGTTCT
TCCACGTGAACACCAACGAGTTCGGCGTCGCGATCGCCAAGTTCCCGATTGTGCCGATGTTTGTGATCACCACCGATACTTTTGCAAACGGCTCTGTCGC
GAGAACGATTTCGTACTCATCGAACTCGCCACCTTCCGTCACAAACACAGCCTTCTTCAGCACATTGAACGCTGAGACGTCGTTGTCAAATACCGTCACG
TTAATTTTTGGAATGATGATCTTGTGGTACTTGAGGTCCTCGCTGTACGAGATGTGTGAGATACCCGTTGTGTGCGTGTCGTACTCGTCGAGATCATCAT
CTGTAGCTTGGATGAGCACGGTCTGAGGGATATCCCAGTCCTGAGGCGTAAAGATAAACTCTTCAACTGGGATTGTGAGATTACAGAGTCCAAACCGATA
ACAACCGGTGTTGCTCCCGTCCAGCCAGGGGAGCGCGACGATCTTGACATTGTAGAGCGGCTCCGTCTTCAGCTGAAGCTGGTAGGTCGCATCGATCGTA
CCGTCCTCGCTCACTTCCAAGTACCTCTCGGAGACCAGCACTTCGGCGAAATCATCGCTCTCGACCTCCACGAGCACGGGGTCGAGCGCGAGCTTCGTGT
AGATCAGGTCGTCGCCAAACACCGTGTGTGTGACATTCGAGAACGTGACGTTGCCGTTCTTGACCGTCGTCTCGTCAATGAAATCGTCCACGGACGAGAG
TAGTACTTTCTGGGGAATGCACCAGTTCTCGGGCGTGAACACGATCCACGGGTTCTCGACCGTGTAGTTGCACAGGAAGCGCTCTTGGATCGTCACATTC
GTGATGTCGTAGACGCACCAGCCTCTTAGCGCAAACGGGTCGCTCCTGTCCGGTTCAAAGCGTGCTGTGGGGATCGCCAAGCAGCGCGGATAGCCTGTCA
GGTCGAACTCGGTCGGCACTGGCAGCGGTTCGATCTCCTGGGTCACTAGGCTGGCGTTGATCGTTAGCTTCAGGTCCTGGAACTGGATATAGTCCTCAAT
TGCCCACTCGAGGCGCCACGTGTGCCCGCCGTCCAAGTACGGGCCTTCACGGTACACTCGAACGCCCTTATCGAAATTGATGCCTCGCCAGACCAGCGTA
TCTGGATCGAACTCGGCCTCGCGGTTAGAGCGAACGAACGGGATCGCCTCGAGCGCTTCGTCCATGCCCACAGCGCTCACGTTCACAGGCAGGTTCCACG
TCTTTCCAGTGTACCACACTTGCTTGTCAACGTCGAAAAGGTCGAGCGTAAGCGAAAACTGACCACTGATGTACGTCCCATTGGCGATCGTGGCCGACGA
GATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCAGTCAGTGTCTTGGAGCCAAAGACGCGGATCGGAGGCAAGTCTCCGGGGCTGTTGCTG
TAGCTGATCGTCCACGTGTACCCGTTGCAGACCCCAAAGGCGTCACAGTCCAGGTCCTCGCGCGTGACGTGTGTGAGTTCTGTGATGTTGAGGTCAAAGA
GAATCTGCTGTAGTTTCGAAGCCGTGATGTTAAATGGGAGTGCGGTCGTGTTCTGCAGCGGGATGTCCATCCAGTACACCCTTTGCGTACTCGGATTCGT
CTTCTTGAACCGTCCGCCCATCTGAATCACGTACAAGCCGCCGAGCGATTCACCATCACGGACCGTGTCGACGACCACCGCGACGTTGCGACCTGTGAGA
TTGAGCGATTTCACAGTCAGCGGACGCATTTGGCCGTTGTTATCGGCAAACTCGATGGTCCACTCCATTCCCCCTTCTGCAGATAAGCGTCGCAGCGACA
CTGACACGTTCCCGATGCCGTTGATGCGCGAGATCTCGGTCTTCATCAGTGCCTCACTTGCGTTCCATGGGAGAGGGTTGGTGCGCGTGACATTGTTTGT
CGAATTGAAGGCACTGACGTACTCCACTTGAAATGCGCCGTCGACGAGCACGGGGCTCTGGGTCTGCGTCGCCACAAGTGACACGTTGCTTGCAGCTTTT
GAAGCAGCAACGACACTAGAGTTATCGGTGAGCAGCGGGTAGTAGATCTCCACGCTCTTGAACGTGATCAGGTACTGAAACCCGTAGGCGCTCTGGTGGA
TCGTGCGTGCGACAGAAACAGCGTAGATAGGCTCAAGATCTCGCAGCATCCTCTCCAAGTCCAGCGCTTTGGTCAACATCGGCACAACAAGGAGCTGAGC
GTCTGCGCCCCCATAACGCAAACCAAAGTCCCCGCTTGGAGCGATGGATGCGCTTCGTCGAACAACCGCGAGCGTGCCTTCGAAGAGCGCGTTCAGCGTC
ACTGAGAGCATTGGGAATAAGGCGTCCTCACTGACCAAGCGCGCAAACGTGATCTCCCAACTCAGCATCGACTGGTCGTACCTCACATTTCGTGAGACGC
GAAAGCCGTTCGTGACCTTGAAGAGCGTGTCGAGGGCAGCTTCCACTTGCGTCGCAGTCGCAAATGCGTCGATAGAGGGCGAGAAACTGAGTTTGCGATC
GGAAGCTCCAATTTTGAAAGTTCGTCCGTAGCTCACAGCGCTCCTGATCGCGTCCGCAGACTTGAAGCGCAGCTTGAACGAGTCGCTAAACTGGAACGTG
ATCATTTGCACCTCTTCGACAAACCCGCCGGTCACTTCGAGGTGGACAATCTGGTCCGTGTGGTCCGTGTACGTCACGATGCGTTGTACCTCGATCACTT
TGGGAATCGAGAGCGAAATCTGGTGGATCTCGCGCGTCGAGTTCGTACTCAAACGCACCGACGTGACGCTCTGCTGACGCGGTAACCCACAGGAAGCGTT
ATCAAAGTGATACCCGCACGGTCGATAGCACGATCGGTTGGCTTCGTTGCTCATCGCAATGGTCACGTTCGCCCACGGCTCGGTTTGCAGGCTGAGCATG
TAGTAGTTTGCAGTTGAGTAGTTGAAAATAGACTGGAAGCCTTCGCCATTTTGCTTCTCCGCGAGCGTGACGTGCTTTAAAGAGTAGATCACATCAGCCA
CGTCATTGTCTTCGACTGCAACGACGATGTCTGGCAGAAAGAGATTGTCGTAGACTGGATCCAGGCTCTTTGAGCGCGTCTTGATACTCGTGAGGTGCAG
GTCATCCTCGTCCAGCTCGTCGTCGACAGCGACCACGCGAATAGTCTGCGGCAAGCTCCAGTTTGCTCCAGAGAAGTAGAGCACATCGGGGGAGACCGTG
ATGTTGCACAGCTTTGTCGGTGTGCTCTCGTCGTCACACGCTAGTGTTATACTACCATTCCTGGGCGCTTGCGAAGGACACAGCGGAGTTGCATAGCACG
CTCGGTAGCAGCCATCCTCGACGCTGATCGAGATCTCGACGAGACTCTTGGGCTCCGAGAGTAATAGCACCTGGTAGTCGTTGCCCTTGCCGTTCTCCGA
GACAACCAGGGAGCTGGTTGAGAACTCGATGCCCGGTACTGTCGCGTCAATGATACCCACAACCAGAGTCTCGATCTCCAGTGTTTCGTTGTAGGGCTCG
TTAACTGCCAAGCCGTAGGCTATTTGCTGGGTTGACCACTTGGCTTGGAGCTCAGTGAGCCCAGTTTCACGAAGTTGAAGGACTTTAGAGTCAACAAGAA
CACGTATCATCTGCAGATCGTGGTAGAACTCGCCCACAAGCTGCTCGTACTCGCTGAAGATACTGCTACCACCGTTGTTCCTATTACTAGCAGCGAGCAG
ATCCAACGTCGTTGCAGTTGACATGAGCTGATACGAAGGCTTGCTTACTGTTTGATGCATCAACTGTGTGATATGTGCGCCTTCGTAGAGCTGGTCGTTC
GTAGCAACAACATGGATGTGCGTCAGTTGCCTCCAGTTCTCCGGAGTGATCACGATCGCAGAAGGAACGATCGATACGTTGCATAAGTTGAAGCGATAGC
ACTGGGACTCGGCGTTGATGTTGATCAGCACTGGCGCCAATGGCTTGGACATCAACCGCAGCGAATACGAATTGTGTGATGACGTCCTGGACTCTGTCAC
CCCTGAGATGAAGTCGTGGTAGTGGTCAAGAACCTCGGAACGACTGAGCGCGCGCAAGTACCACGCCACATTTGAGATCTGCCCGACAAAACCCGGTTGT
TTGGCAGTGCTACTGCTGGCTGGCGGTGTGTACGATCCAAAGTTGAGCGCCTTGTTGAACACATTGAGCATCGCCAGTGTGCACGTGGTCATCGCGGTGC
TCCGGACCATCTCGCCGCCGTCAAAGCTGTTGTAGCTCAGCGAGAGCGCGATTGCAGCAGTTGAAGGGTCGTAGGACGCCACGACATGGTACCAGATCTC
TGTTTCTGGTGATGAGGACACTACTGGATCACTTTCGACCGCAGTCGTGCAGCTCTTTCCAGTTTCTGAGTCGACGAGCTTGAAGAAGCCCATGGGATAC
AAACTCGACAGTCCAACGGACGCGAACACGACGCTCTCGCTGTCCAGCGTCACGACATTGACTGGAGTAGTCTCGGAAGAAGCGACGGGGCTTTGAGTGA
AGCGGACCCAGAACTCCAACGAGAACGCTGGCATTGCGGGCTGCAGTAGCACCGCGTTCGAGTAGAACGAGTCCTCTTTGTCGTCATCGATCAGAAACTG
CTTTGAGAAATCAACTGATGCGAAAGCAAGCGCTCCAGTCGCGCGACCACTGGTCGCGTCCACGCCCTCACTGGCAACGGGGATCTTCGGGAGCTCATCG
AATGCCCAAAGCACCACGGGGTTATCACGCAGGATCAGCGCGCGATGCTCATTCACTGAGAGCGGCAGGCGTGAGAAAGGCACAAAGTCTGCCATTCCAA
AGAGAACGAGGTCAGAGAAGTCGCTCAGCACCAAGGCAGATGTCGCCCCCACGGCTGTGGTCTGCGAGTTGCACGCTGTCGTTCCACAGGAGAAAGCCTT
GCATGCCGACAGAGTCGAAGAGCTCTTGACAACTCCCATCGCATCGATCTCGCACGTGGCAGACAACGCGACTAGCGCACTCGTCGCTGTGCTGCTCCGA
ATACCGTCCAATGCTGAGCCATACGCTGCGATTGAGATGGACTGGACTTGGTCCACTTTGTTGCTGACACCACACTTCGCAATGCTGGTGTCCAGCTCAA
TGAGACCGACCTTAGTGGGCTTGAGGAGGTCCAGTACGATCCATTCGTGGAAACTTGCCTTTGTCGCGATGTAGCAATCGCTATTAACCACGCTCGTGAG
CGCAGCCGCAGACCCAGAGCCGTCGGTCGCAAGCTGAGAGCTCACACTGTGGATGTTGTAGGGAATCGGGATAGCGAAGCTGCCGGGCGCTGAGGTTGCT
GTTCCGGCTGAAAATGCTGTCACATCTGTCGGTGGGAACAACTGGATGCTCGACAACGCCATGGGGTTTCCGCCAAAGCCATGCAGATCCAGTAGCAAGT
AGCGAGGGGTGGAGCCTGGATTCCAGCGGTACACCTCGACTTCGTTCAACATCAGCACACCGAACCCCCGCTTCCGGATGGTGACGAATCTGCCTTTGGT
GAACGCGTCCGCCCAGGTTACCGAGGCTGTTCCGTTTTCGCATGAGAAATTGAGTGTCGTCTTGCGCGTTATGAACACCGATGATGGATCGCTGGCTGTC
ATGACTGAGATGTCTGTGATCAGCACCTCAAAGTCCTGTCGAAACGGCTCTTCCAGCATCAGTAGACTGTCGGTCCGACTGTAGCTGTAAAGGTCTCCAC
TCCACTCGGGATACTTGCCACTGATAACGCTATTGCTACTATTGATGGACGTTGGACTGCAAAAGCCGCGTCCAGACATCCCAGTGAATGGGTAGAGTAC
GACAGAGCTAATCGGCTTGATCGCTCCCAGGTCAACCTCCCACCACGGGCCAGTCTCGAACTCCGTTCGAGTGCTCCCAGGTGCAAGTAGTTGCTGTGCA
CCTTCAGAGCCCGACTCCATTGTACTGTTACTCTGCATAGTTGAGGAATCCCACAGAGCAGCGCGCTCCCCATCCACGGCTAAGTACGCGAACGCGCTCT
CCTCGTTGGTGCTACTCTGTCGAGTCGCCATCCCGATCGCCAGGTTTTCATCCTCGGATCGCTTCGCGCTTTGCTGGATTCGCCACGACTCGGAGGCTCT
CTGGGCTGACCAATCGGTCTTCATCCGCGATCGGAGACTTGATGCATCTGCAGTCGGTGTGACTGACACAAAGGAATCGTATGCCTCCACTTCGACAAGC
TCGAGGCTTCCGGTGCCTTCTCTATAGACGCGCAGGCATCGCACACCAGCTTGGAGGTCCCACAGAATGATCCCATTGCGCACCACGATGCGACGCGATC
GTGGACACGCCTCGGGACATCCAAACGAAAGCGCGTCTTGTAAGGATAACGGCGCTTCATTCAGTTGCTGCAACGATGCCACTCCCACAATGTGAACGGT
TTCTTCACTGCCGTCCTCGGCTTGAACTGAGTTCATGGACTCTGGCAGGAAGAATGCGACTTGACCGATCTTCTTGATCTCTGCAAAGCACGTCTCCCAC
CAGGGCTCGAGCTCGCTTTCGGTTGCCGCTGTCCTGTTGACGCTTCGGTTGCCGTCAGTAGCGATCGATGCAGAGAGCGGTTCTGATGCTCGTTCCGGAT
CAGATGAGACGGCAGTGGAGCTCTGTGTCGTCGTGCCATGAAGCAAAAGATTCGGGAAGCGGTACCCGAACTGCAAGGTTGGTCGTAGCTTCCGCTCAAA
CAGCGACGAACATATCTGCGTGACCGACTGGGTCGCGTTCTCAAATCCGTTCAGCACCTCGATCTTAAACGACATCACCGCAGCTTTCACCAGCAGCAAC
TGTGCTACAAGCGCCGTCACGTTCAGCTCGATCGATCGGCTTTTCTCGACTGTGGCTGTGACATCGATCGACTTGAGCGCAGCAAATGCTAGATCCCCTG
GGAGAACTGAGATATCACTCGCTTGCTGGCTGACGCTCTCTTGGCTCCATGCGTTCTGCACAAGTGTGATCCGGAGCCGGTAGTATTTTGTGAAAAGCCC
TGCGTCGCTGCTGTTCAGCGTCAAGTCCTCCATCGTATCCGAGACGTTGAAGATCTTGAATGGCGTCTGATGAAACCGCAGCGTTGCAAAGCTGAACGCG
AGTCTCGAGTCCCCCTCGTGGGTGTACGGCAAGTGGAACTTCATGTACGACGTGGAGTTTGGACCGAGGACGATGATATTCTCAAGCGCAGTTCCCGTAT
CGCCGCCCGCGTTTGTGGCTGTGAGTGAGATGTCGCTGAACGCGAATGACGTCGCGTAGTCCCCAACCCAGTCGATGGCGTCCGCCGATTCTTTCGTACT
CAGATCCTGTCCCGGCTGGTTGACAACCACTGCCACGCCTGCGTTGTCGTTGTCCTGCACTTGTACGTTGATGCGCCGGTGCGCTGGTGCATTCAACACT
GTCGGGATCGTGTTGTACGGAATTAACTCGTATCCGCTACTTGATCTCGGAAAGAGACGCCAGGGTGGCGGTGGGAGCGTGCCGGCGAACCAGAACGCCG
TCGTGTTCGTGTATCCGTAGGGCGAGTTCTGAACGCGATGTGTGATCTGGAATGCTACATCGGCTTCTGCGATATCGTCGTTAGTTGCTTGGACGGTGAT
CCACTGAGGAACGAACCAATTTGCCATTGTGAACGTAACTATTGACGGCGAGACGTTGACCTGGGCGTTCGCGATGATCGCGATGCTGACGTTGGCTGGC
TTTTGTTTGCTATACATCTGCGCTGCTAGTGCAGAGAAGTCGTCCCAGAATCCGCAGTTGTCTGAGCCAAGCTGGTTGCACACGGACACTACAGGCTGCA
GCGAGCCACCATTGAACGACGGAGGTGCGTTCAGCACAATCGAATACGTTGCCACCGAGTCCTCACTGGATTCAGAGTCGCTCTCTCTCACAGCCAGCGA
CTGACTTGATAGAGTGACGCCTGGGTCATTGTCCCAAATGGTGACGTTGATGCTGCTCCCGCGTCGAAATACACTCGCGCCGCAATTCCACAGCCGCCGC
TCGTCGATGATGTCGAAGAACATCTTGAAAATGGTCTGGAGAACCTGTGCCACGTACCCGCTCGGCCACTCTCCAAACGCCCAGCGGTGAGTTTCCAGTC
GACCAATCCCTGAGCACACACAGTGCAGGACTCGCTTCGGATTTTGTCCCAACCGTTGAACCTGGTCGAGGTTGAGTAGACCTAGGAAGCTCAGCACAAA
GCCGCGGAGCTCAGGCGGGGGCGGCACAAATGATAGACCTGACGGGCTGAGGTTGCGAGCACTGGACGTGTTTCCGTCCGATTTCTCATCCAGCAACAAA
CGCGCAACTTGAGGGTAGGATATCGGTGTTTCTTCGGTGCCATCTCCGATACTCCAGAAACTTGGATCGAGACTGCGGCTACCAAAGCGCACCGGGATCC
CATCAGCGCTAGATGAAGGCAACACATTTGCGACACAAGCGCCATTTCCAAGCGTGAAGTTGCAGTTGCTCGTCAAGTCACAAACTCGAACAAGGAGGTC
TTGAGCTTGAAGTTCCGGATGCAGACAGTCTGTCACTGACACTGGGTCGCAGTTTGGCACGTCAAAGCATTGAGGACGGCGCGTATGGTACCGGAAGTCT
TTGCTTTCGCTGTAGTGGACGAGCTTCCCGCCGTAATGCAACCCTCCAAACTCGACTTCCGAGAGTGCGTCATCAACGGCTGACACCACCACAGTTTGCG
AGATGTTCCACATCTCCGGCGCGAATGTCACAAATGGCGTCTGCACCTGGGTTTGGTTCGAGTGCAGCGCAATAATCGTGATCGTAACAGGATACCAAGG
CATCGAATTCAGCACCACGTCGTAGCTGTCGTTCATTCCGCCTTCGCCGACGTACATGTGCGATCGCGAGAGCTTGATGCCAGCAAAGTCGTTGTCATCC
ACTTGCATCGTGATGTTTCTGCCATAGAGGAACGGCGTTTGCGATCCATTGAAGTTCGGATCGAGACTGGAGCACGAGTGGGTGATCACAGAGTAGTGGA
CGCCTTCAGCGAACGCATCGTCGACAGCAGCGACCCGGACGATCTGCTCGCGGTTCCAATTGCTCTTTGTGAACGTGACTTCGTGGAATGTACCGTTGGG
TAGCTGCAGCTGCTGGATGGGGACTCTGTTTGGGTTCGCCAGCTGCACAACATCCGCACGCACCGTCACATTGTTGAGCGGCTTTCGGTTCAGAACGATA
CTGTATTCGCCCTTCACACCGTTCTCTTCCATGCGCTGCCGTCGTGGCGTGATCGTGACACCTCCGTCCATCGTGAAGTCCAGAAGATCGCCTTTAAAGT
TGAAACTCGCAGCGAACTCGTACTGCTGCGAGCGCACGCCTGTTCTCGTGTGCGAATCCATCATCTGCGTCTCATATTGTGCGAACGCTTCGCGCGCTTC
CAGCACACTCTCGACGCCCATTTCGACAACCGTGTCCACTTGGTCAGTGACGCAGCCGCCCGAAAGGAGCAGCGAATTGAAGGTGCGATCGACCACTACG
CCGTACCCAAAGTCGTTCGCTGTGCTTCCAAACTGGTTCACGCGAAGACACATTACTGTGAGAATTCAAGACACTAGAACCACACAACAACTCATTCAGC
ATGCAGGGACAAGCTAATCGCACCTGTCGCGTCCAGAGCTTGTTGCCGTCGCGCGTGAGCTTGAGCAGCACCACGTCTCGTCCCCCAAACTGGCCAAACC
CATTGAGCGCATGCGCGCCTTCGTCCATGAACCCCCACGTCGTCCCGACCACGTACAGCATTTCAGTGATTGTTGTTACGCCATCTTCGGTGGATGTTTC
GTTCACCAGCGTCACGAAGCTTGCTGCATCCGTCTCGTTTGTTCCAAACTGCACTCCGCAAATGGCAAACACAAATGAGCGTCATAGCTTTCATTTAGAA
AAGAGCTGTCAAAGCATAGCAAACACACCTCCCGTGTCCATGCGAGCGTGTCGTCGGCGTTCAGCCGCGCAATAAATAGGTTCTGGTCGCTGACTGAGTC
GGTGTCCGTGACGTACGTCTTGGAGCCAACGAAGTAGAGGTTCCCGTCGACGTCTTCGACTCCTCTTCCGATGATCTTGACCTGCGCGTTTACCTCGCTC
TGCTGCCAGTCGAACTCGTCACTCGCGTCCCGCCATGCCTGGACTTCCTCTGGCGTCAGACTCGCTGCTGCAAACAACACAACACACCACGAAAACAAGC
AAACGAAGAGCTTTGCAGCAGCGCTCATATGTTCTTGGCGACGATGTCTCGCACGATACTCAAATACTGCTTGATATCGTCGGATTTGCTTGGTCAACTT
ATGAGGATAAGCTTGAAAGGTCGCAGCCAAAGACTGCTAGGAATTACTGCCTCTTCGACACAACTCATTGCAAATGGCAAATGCTAGAACATCTAGACTT
TTCATGAATGTCCACCAGTGAATGAATTACAGTCGGCCACTTACTCCCGTTGGTGGTGTATGTATGCACAGCACAAGCACCGTCACCATCAGCAGTATTA
GATGAGCTCACTATCGTCGTCACTATCGTCGAGCTCAAACGACATCGCGTCGACCTCCTCCGTGAGCTGGCTCAGACCCGTGAGATCTTCAAGATACGCG
CTCGAGTTACACGCATTCTCCAAAAGCTGGAACGCGTTGGACTCATAGGCGTCCAACACCTTGGCGCTGCATGCAATACACTTATCGAACGACTCGCCTG
TGATCACCATCGAGTTGAACGCATTCAAGAATCCGCGGAGCTGGTGCGGGATGAACCCCATGGGAGCCGATCCATCAGCAGGTTTCTCAGCGCTTGCATA
CTTCCCGTCTGGCGAATGAAGCACAGCAACCAGTAACTCAACCGCGGTCGCAGACGCAATGGGAGCAAGTCCAGGGCGAGTGACCGTGCACATCTGGTCC
AGCGTGCGGTCTTTTAGCGAGTCTCGAGGGCTCACGATGTCATTGCAAAAATAGCATCCAAGAGCCGATTTCTTCTCGGCACCATGAACTCCGTGTCGCA
TCACCAGGTAGCTGTCAAACCCAAGCGCCGCATTCAAGAGCAGCTTCTTCTTCGATGCAGCTATCACAGTTGGAAGCCATCTGCTCTCGCGCGAATCCGT
CCCCATGAAGATAACGTCATGCTCGTCGATGAGCTTCTCAAGAGTGTCAAGACTTCGCTTCGCTTCTTCGATGAGCTGAGCATTGCTGAGAGCGTGGCCA
GCCATTGGGATAGTCAAGTGCACCGATTTCGAGTCCACCAGTGGAAAGATGCGCTTCATCGCATTCGCAGCGCATTCACCCTTCGGTTTCCCGCAGTCCT
GAAATTCGAAAAGCGGCTGGCGGACCGGATTCGAATGGCTCACCGTCGAGTTGTCGACAAATGTGATGTGTCGAAATCCCCACGACAACAAACTTCGAGC
AGTGTAGCAACCGAGCGTTCCAGCGCCAAGAAGGAGACACTTCGTCTGGGCGATCTTTTCCAGGTCTAGCGACGGCAGTTGTCTCCAACGCATCAACTTG
AGATTCAGGTCGACTGAAGTTTCAGCGAGTCGAATCGGATCGAGGATCCCGCCGAGTTCCATAATGCGAGGACCAAGCTTTCCACGAGCGTTCGCCTCCC
ACCCCATCACACGCACCTCCTTCTTGGATCGACTGCTCGATAAAAACGGCTCGTCGTACTGCACTTCGAAAACCAGCGAGTTGCTCCACTCGAACTCATC
CGGAGCCTCGTTAAAGTGGTGCAAATGCTCGCGGAAAGAGATTATCTTGAGAGGCTGTTCTCGCAGGGCTTTGTTCAGAGGTAGAGAGGTGAGGAGCGCG
AGGTAGTTGCGCAACGGCCATCCCGGATTCGCTTTCAACGGACACGGGTCAACAAACCCGAAAATCGTCTCACCAACCTCAGGATCCGCCACAACGTGTG
ACTTCCAAGACTGCAAAGACGCCACACGCATGGTATTCCCTGACGAGTCTGGTTCACGAAGGCGCTCCATGACGAAAAATGCGGAGAAACCTGCAGCTTG
TCCTGCGCTTTTCTTGCGAAGCTCCAGCAAACCACGAAGCGCTTGAGCTTGCTCGACTGGAGAGAGAGCAGTTGATACAGGAGCCGGGGCTTTACTCTTG
AATGGCGACGCCGGCGTGAGAGCTGGGAAGCCAAACCAGTACAAAAACGAGTGCTTCTTCAGGTCAGCAAACGTCACCAGCACAAACGAGTTCAACTGGT
CCACACTGCCAGCAACAGCATCATCCAGAACCGATTCCAGGATCTTCTCTCCCGCGTGCTGCAAGACCGCAGCTTTATCGAGGTTTTTAAAGTCCTGTTT
TCAAACACACACATCAATATGTTAGGGAACAAATTCTGCATGAGCGCATCAACGTTCTTCGTGGTACGCACCTCAAGCGTGTTGGTGTTGATCAACGTTC
CCGGCGCTTTCCATTCGTATCGCGCTCGATCGACGGCACTATATCGAGGAAAGAGCATATAGGCACACGCCAGAAAATCGTTAGATCATCCAGCAACCGA
AAGCGATCTTTCTGCCCTACTGCTTGTGCGTTAGTGCCGAGCAGGCGCTCACCTCGCGTTCTCCTGTCCGTCGACGACCGGGAAAGAGCTGTCGTCTACC
GTGAAGCGAGACGGCACGTTCACCGAGCGTCCGGGCGTGAAATACCCCGTGAGCTCCTGCCATGCACACACAGGTACAAAACAAACAGTACGCCATGTCA
GTCCACAATCGAAAAAAGGCGCGTTGCATCTTCAACCCATGCACACACACACGCAGACACGCAGAAAAAGCATCAGTACGAACCTGCGCCTGGTCGCTGA
GCTGGAACGTGTTGAGCTTGAGCGAGGCGAGCTTCTGCCAGAACGTGACGTCCGGCGCGCTGTTCCAAGGCTGAAAGCGCAGCGTCTCGTAC