Description :
From Genome Similarity Track
Location :
Scaffold_1140:1095- 5199
Sequence
4104 bases(100 bases per row)
GGGTGATCAGCCAAATCCTGAATGATGTTCGTGTGGTGTTCGGCTCTGGCGCGGTGTCAAAACGTGTGCTACTGAAGGCTCATCAAGGATCTGCTGCATT
CCTCATCGGTGGGCGAACACTGACGTCTGCACTGGGACTTCCAAGTCTAGGCGGGTCAACATTTCGCAAAGAACACGCCCCGCTCGTGTCCTCAAATGAA
GGCCCGACCACGTTGCGGCGATTGCAGAACCAGTACGAGCAAGTTCACTTGATCGTCATCGATGAGTTTGGTGTAGTCTCATGCGGCATGCTGTACTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCGACCAGCGCCTGCGTGAGATATTTCCGGCCCACAGAGAAATACCGTACGGAGGGCGTGATATCC
TGTTCACAGGCGATCCGTATCAGCTCGGACCTGTCTGACCAAGCCCCCTGAGCACATCAATCGAGTTTCTCACTGGAGACGCAGAGGCAGCGGGTCAAAA
GTTGTGGGAGACGATCGATCTCTACTTCATTCTCTGCCAGCAGAATCGAGGCCTGGGGGACCCTGTATGGTACGACATACTTCGTCGCGTTCGTGAAGGG
AACGCAACTGAAGACGACGTGCAGGTGATCAACACTCGCGTGTTCCCACCTCCACGAAATGTTGCATCGCACGCCGTTTATTTATCGTACCGAAATGTCG
ACGTTGACGTAGCAAACGAGTTTGCTCTCAGGAATCTCAATGAACCGATATGCAGCTTCAAGGCTCAACACAGTGTTCAGTCACGCATGGTGGGGAACGA
AGTTGCTGACCAAGGAACGCAGCGAATGCTTCTCGATGAGGCAAAGTCGATGAAAACCCCGACCTCAAAACACTTACCAGTCGAGTTGAATTTGTGTATT
GGAGCACCAGTCGTCTTGACCACCAATATTGAGCAACGGGCGGGGCTGTGCAATGGGTCACGAGGCACCGTGTACGATATCATTGCTGATGACGGAGCAG
TAAGTTGCCACCCGATTGTGCTTGTCCGACTCTTGGACTACAAGGGACCGTCATTTGTTGCAGGCGTTGCCGGGGTTGTCCCAATTGTCACAAAGACCGC
GGCATTGAATACGAAGCGGGACGGAGTTCACAGGGTCTCCAGAACTTCGCTTCCTTTGCGACTTGGATTTCCAACGACTATCCACAAGATCCAAGGCCAG
ACATGTGACGCAGTTGTCCTCAATCCGGTGTGTCTAAACAACAGTACGCTCGCATACGTAGCGCTTTCGCGGGTTCGTCGGCGAACCGATATGTTTATTT
CTACGCCTATGACTCTCAGTCAGCTGACCAAGTCGCAGAAAAACACCGTGATCGAGAGAACCGAAGACGCGCGTGTAAAGAAGCTTCAGCTAAAGTCCAC
ACGTGTGTCGGCGAGACTGATATCTCGAATGAAGACCATCGCTAACATGCATAACCTCCACACCGCATCCATCTAGGGAGCCTCGAGCAGTTTGACAACT
GTATCTCGTGTCACACGTCACAAACGCTCCATTTTATCATATTGCAGTATATTCGTCCTCCACACGTCATCACCTCTTTTTTTCAATAGATCTTCATAAC
AAATGGATATTATTCTGGGATAGCCGAAGCCTTTAAGGCTGGGGCTGTACAGCCCAAATCACTTTAATTTGCCACACGAATCAGTGAAGCCACCTGATTC
GAGTCAGGCCTAATCTGAACCCTACAATAGGTTCGAGGTCGTCCATTGCGACGAACTCTAAGGTTCGCAGCCATAGATCTTGACATTTGACGTTTCAGCA
GGACGTTGATGAACAAAACGTTGATGTTTCAGAAGGACGTTGACGAACAAAACGTTGAGTTGACTGCTCACATATTGCCGACAGCTCGTTCAAGGTTGAT
TTGATGTGGTCGATGGCGATCGAAACGTTCTCTTGACTGCTCGTTCCTATTGCAGGGGCGTGTGGAGGGCATGGCCAAAGCGAGAGCGAGCGTGCTCAGC
GCAGACGACAGTCGCAGGCCGCGGCACAGCGTATTCGGCGTGCGCGTCAACGAGCAGATCGACAAGGATCGACAACCGTCCACCAGGTTAGCGCTCGTCG
AATTGAAAGCGACCAACAGAAGGAGGAGCGATTACGGCGCCAGAGACTGGCGCGCCGAGAAACTGTCGCTGCTCGGCGACGTGATGATCTAGCTCTCCTC
GGGGAGTTGAGCGATCGCGTTCTCTCCGTTACGTCGCTGACGAGGGAGGAAATCACATGGATGCAGACAAGTCAACGCTTCACACGGCATCCGAGACTCG
CTCTCGCGTTTTTCCACTGCTGCGGTACCGATCCTGGGTCGTTTATATTCGGTGATGAACAGTTGCTGGGTGAAGACAGCCAAGATGCCATTCAGCGTAT
GACGGACTTGCTGGACGATATCCCCAACGTTCAGCATCTGACGACGTGCCAAAAAGACGTGATTACATCGAGTTCAGAGGAGACGGATCTCTGGGCATGT
GCATCGTGTGGTCGGATACTGCCGAAGAGCAGTGATGCGAACACATTCTTCAAATCGCTTCCCCAATTGCGCGGCTCACTGCTTCTGGATGAGACAGAAC
GCTCGAGACTTTTTGAGCGAGCGAGCAGGTGTGATGTCGAAAAGTATCGTTAAGTCCTGTTTGATGGGGAATACATATATTTTCTCATTCCAGAGCTGGT
TCGCAATCGTGACGAGATCCCGCTGTGTGAGAAATGCTACGTGAATCCGCGAACCAACAAGTTTTGCGTTGTTTCAGGGCACGACTATGGGCGTGTGGCT
CAGTTACCAGAGCTCAGCGCTGTTGCTCTGGCGTGTATCTCGCCCGTTCGGTGCTTTGGTTTGGAGTTGTCGCTGTCTGGTAAGAAATCGTCGGGCCGGA
CCGTGCGAACTATCTCGTAAACTGCCTAGCGTCGGCATTGACGCCATGCCCAGAGTTACCTTCGTGGGTCCAAAGGAGGAGTGGCGCGTCCAAAAACAGA
AATTTCGGAAGGTTTACGCCATCAACGAGCACGACGTCTTCGAGTGGCTACGAGTATTGTTGGTCGTGAACGATATTTTTCACGACGAAGAAATCTGCGC
TGAAGACAACCCTGCTCGCTGCCAAGAACTACGAGACATGGAAGCCGCGATTGATGCATCGGTACATGTATCAGAATCAGCTATCGCCGCTTCAATGCAA
GATGAAGCTGATACAGTCGGGAACGCCGCTGTGGATGCTGGAGCGAGTGATACAGGCAACGACATTGTTGTGCGGCAATCAGCTGTATTGCCGCAGGCCC
AACCGAATGCTGGTACCACGCATGAAATCGTCGATGCCTTGATTGCCACCGTTGATGGTTCCGTACATGTGGGAGTACACAATCAAGACCATCAAAGAGC
ATCTATCATTGCTGTGAAGCGCGGCAGTACACCATTTGTGGAGTGGAACGACAACGCCAAGATGCTTGCGGGTATTTTCCCAAATTTGTTTCTGACCGGT
GCCAGTACGTTGCCCAGTGGACCGTTGCCACGAGACTACGTTGACCACTTCATGTATTATTGGGATGGACGCTTCGAGCAGTCTGTTACGTTCGTGTCGA
TGCTATTCAATCAGTTGCAGCGCCATGCTGCGGTTCAAAAAGCTGCTAGAGTGGGAATGACGCACGACCAGACGGTGAAAAGATTTGGTCAGCTAGCCAG
CACATCTGCATTCCGACGTGCTCTCCACCAAGCAAGTGAAAATCCAGATACTCCACAAGCCGTTCGTTTGAATGCGGCTCTTCTTCGGCTTCTATCGCTT
GTGGGGGATTCTGTCCCATTCTCTCCGTTTGAACGAGCGACGACGCGCCCCAAGCTTGGCGCTATGAGATATCGCTACGGTGTTGCGCAGCATTTTGTCA
CGATTGCCCCTCCGGAGCATGATGACTTGCTGCTTCTTCGAATGGCTCGACTGCGAATGACCAGCGCATGGAACGACTGCAGTGATGCATGCTCGTCAAA
AATATGCAGAATGACGGATCTTCCTCAGCAACTTCAAGCCAGTGCAAGAGAACGTCTGCTTGTCACCAACAAGTATCTTGCACTAGTAGCCCAAATGTTT
GAGC