Description :
From Genome Similarity Track
Location :
Scaffold_165:10948- 13259
Sequence
2311 bases(100 bases per row)
CTTGCCGGATCCGACAGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACGGCCCGCAGCACTTCTTCAAGCGCATCTGCGTCTGGAAGACGTAACAGG
GTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGCAGTACCTTGGATCCCCATCCTTGATCTTCAACTTGGC
CCGTAGATCGGCCACATTAAGCCGATGAAGATATTCCAGCGGGGGTACGTCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACCCCCAAT
CCAGAATACTGGGTTTGGAAACTGCGCAGCAAATCCGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGATGGCCCCGCTAGCA
GATCTGCAAAGGTCAGACACTTTTCGGCATTCGACGCTTGGTCTCTCATGGGGGCCGACTTGACTTTGCTGATCCATGTTCGCGCTCTGTCTTCGTCTTG
ATTCTTGTTCGTGAACTCCTTCAGATCCGATATGGTCGAGATCCGTACTCTCGGGATCATAGACGATCCATCCGCCCCAGCCGCAGCTGTTGCTACCGCC
GCGGGCGAGGGGGATGGGACATCCAGAGCATCCGGATCGAACTCATTAAGGGAGTTGTCTCCTTCCACTGACTCCATCTCCATGTCTCGTGCTCCATGTT
CATGGAACACTTGCGCTTGCGGCTTGGGCGCTCTCATGCCGTGTTCGGCCAGGAAACGACTCATTGCAGCTTCGAAGTATCGTTGCAAGGTGCCCGAGGA
GGTGCCGTAGCCGTCTGGTCTACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGG
CTCGATCCTGGCTGGATGGTATCCGATCACGGGTATGGCGTCCTGGATCCCGAGTCTTCACACTCGACGGTGCTTCCTGACCCCGGATCCTCGCCCGCGC
TTCCAGCATAGATGCCCCAGAGGGTCCTAAAGTCATGCGTCGGGGCTCAAACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCA
GCTTGGCTGATCCTCGGCGACGTCACTGGATCCATAGTGCTCGACCTTTCTCCGGTGGTGGACTTGACTCTGACGAAGAGGTCCCGCGTCGTCGATACTA
TGAGATCCAAGTCTAGCTCGCAGATATCCTCTTCATCGAAAACACCAGCTACGATGCCTGAATCCGTAAGCGAACATAATAGATCCTTGACTGCCACCAA
CTTGCTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCCGCAAGACAGGATCTTGATACCGAAAATCC
GCGTAGAGCTTGGTGGCGATATTCGAGCTCGAGATCCTTGTCGGACCAGCTTGGCCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATTTGC
TTCCGCGTAGACTTACTCGTATCTGTCTTCTTTCTCGTCTTTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTGACCGGTGAATCTGCTAATG
CATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAATATCCGCAGGGGTCCCCGAGGAGACCTGGGGAGAATAGAGAGG
TTTCACTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGGCGACCGAGTTCCTCCCAGGACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTC
TTCGTCGATCCGACCTCCGATGCCGCCTCTTCCCCTGGCTCAAACTTCACTTGAGCATCTTCTTGGGACTCACAATGAAGTTGCGAGTTACCAAAAGATC
CGGGCACGCGCGCCAATGTTGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAACTTACCAACAGCGCCCAGACACCGACTAACGGAGGGGT
CCCCCGATGATCCGTGTTCTGCTGAGCTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAGGAGTTCAAGTGGT
AAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTCGAGCAGCAGTGATATCTTCGCGCTGCGTCCGTGGTTGGTTCTGGATCCTAAGCGAATATTCG
AGCTTAAGTGGATCCAGGGCCTAGATCTGGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGGTGTCGTACTTGCCGCCTCCTGTGACGGGAT
CTTGAGAGTTG