Description :
From Genome Similarity Track
Location :
Scaffold_117:109468- 116788
Transcript NameFunction/comments
g15517.t1KUF86832.1 E3 ubiquitin-protein ligase UPL6 [Phytophthora nicotianae
g15518.t1RAW41766.1 hypothetical protein PC110_g2033 [Phytophthora cactorum
g15519.t1XP_009534759.1 hypothetical protein PHYSODRAFT_549244 [Phytophthora sojae

Sequence
7320 bases(100 bases per row)
CACTAGGTCATTTCAAAGCCGGCGCCGGAAGAGATGGAGGTGAGCAGCTTGGCGCGAAGCACCTTGTACGACGAGTATGTGGGCAGCTTGAGCGTGTTGA
AACACGTGGAGGAGCTGGGCAGCAACTCGTCGTCGCTTCGGATGGGAATCTTCTGCACGCAGAACTGGGGCGTGAGCGACCCGAAGCCCAGCGACGGAGC
GCGTTGGCAACTCGTGGCGAAGCGCAAAAACGCAGCCTGCTCGGAGGGCGTGAAGCTCGCCAGCGCCTGCCACAGCCACGCGACGCGTTTATCCAACGCG
TAGTAGCCGCCAGCGTAGCGTGCGTTGGCCTTGAGATCATCGACATCGATCTTGCCGCTTTTGCCTGAAATCAGCACTTGCAACTCTGGCTCATTGAACA
TCTGGAGCCACCGCGGGTGGATGAGGTCTGACAAGCCCATCCGGAAAGCTGCGCATTGTTCGCGGATCTGCGTGTTGAGGTAGTAATTCGCAACCAGGTG
GATATACCGCGTCTTGTTTCGGCTCGTCACGGGCACATTGCCTCCTCCCGGGATGATTTCGATCTCTTTCTGCTCTCCAAAGACGTCTTGAACAACCGTG
TGCGTGAGGCCAAGGTCCTCCACGTCGCCGTCGTAGGACTTGAGGAACATTAAATTCTGCATCACAAAGAATTCGCAGCATGGTAGAGCGTCAGCAAAAA
CGTTCGGCATATCGCGTCTCAAAAGCGCGTACCTTGTAAATCTCGGGGTCCAATGACGGCAACTCGTTCAGTTGGTTGAACGAATGCAAAAGCTTGGAAA
GAAAGAAGTGGGCAAATTTTGGCTGCACCACAATGCCTTCATACAACGCCTTTCCCAAAATTCGGCCGACGAACTGGAACATCGTCAGGTGATCACTCTC
TCGTGAGAAATGGTCTGAGGCCGAGTTTGGGTTCGGATACAAGAGCTGGTCTTGGGTCGTGAGAAAGAGTCCATACTGCAGATCAAATGCGAGTGTCGAC
AGGTCCAACCAAAACTCTTTGAAGAGTCCTCCAGCATCAATGCCCACTTCCTCGCGCCCAGCGGAGTTCACGAACACCACGTTGATTCGCTTCTTGAGGT
TTGTACGAATCGAATTGAGCTTCTTCAGGCCGTCTTCCAGAATGGCACCTCTGTGAATGCGAATGCGGTATACTGAGCAGCTTTCGTTTTGGTGAACGTC
TTTGTCAGCCTTGACAAGCCGCTGGAACAATTTGACGCGGTCAGGAAACGGCACCAAATATGGCATCGACTGGATCAACTTGTTCGCACGTGGTGTGCCC
AGCAACACTTCTTCAATCAATTGGTTGCTATCCAACTCAGTAATGATCCTGCAATATCAAAATCCATCCAGTATTAGTCATCATCCGATAACTATCAACA
ACATTAATAACACACCAGCTCGTGACGTTGCAAAAAGGCTGACGAGAGCACCGGTTGTACAGAACCCTCATCAACCGAGTTCCCGTCTCAACGACAAACA
TGCCAAATGCCACCGATTCGGAAGATGGGGCAAGGTTCGCGAACGTCCAATACGCCTCATGAAGTGCATGCTTCAGGCTCAACACAATCCGCTCAACCTG
GCAGATAGGAAGAGGGTACTCCTGCTCGTACATCTACAAAGGCGAATCGATGAATAATCGGCATATAGGTAGCGGTGACAGCTCAATCGAACAATGGACA
CGTACCTCTTCATCGTCCATCACGACCAGGAGATGCTCGTACGTCATACAAAACAGCACTAGCATGCACACGTACGGATCGGAGCTCCGCGCGTGAATTA
AATCCACATTCTGTCGCGCATCTCAAGGTTAGTTTGTTGGAGACAGAACATACACTACCGAAAGAAGCCGTACCTTCGCGAAATCTTCAAAATCCTTGGT
GTCTTGTAATACACACCACAACATATTGACCAGCGAAACATTCTCCACAGTGTCTCCTTCGTTTCCAGTAACCTCGACATGATAGAAGGCAAGCGTGTTC
AGAAGGCGCATTGCGTGTGACTGGCGCTTTCCGCCATCGTTTCCCCATCGATACAGGAATGTGCCACACAAACATGATAGTGCCTTGATGTTCTCCAGAA
TGAAAGGCTCGGTGCCTTTCGACAACTTCAGCGTTGCAGCCCGCTGAGTCGTGGAAGATAGATTGTTTATCCCGTTCGAAGCAATATTCCGTGCTTGCTT
TGAAGTATTTGAGAGCCGAGAAGCACCGCTAATACTGTTTCTCTCCTCGCCATCCTCTCGTCTACGTCGTAGACCAGCCTTTTCAAACAAATTTCTGGCC
CACGTCGCCTTCCCAATTGATTTCATCTTCTGCCACGTTACTGAAAGTGATGTGGATAACGATGATGCTGACGCGATGTCACCGAAGCCAAATTGTTCCT
AAAGAGGTAGCAAGCATAGAGAAATTGGTCAGCTTGTTCGCACAAACTAGCTAAACAGTTACGCCTACCGCAATAGTCGATGCATCAAGATACATCGGTG
TCGGTCGTTGGGTTTCCAGTGGATGGCGAAGCGCGCTCGGGGAGAAAGAAAGAAGGTGATTACATATTGAGCGCAAGTACTGATCATTGACCAAAATGTG
TAGCTGCTCGTTCAAAGCCTCTGGAAAAACGACGGGCATGGAGTGAGACTCGGATACTTTCGTCCACGAAACAGCCACTCCCGATGCAGCGTACGTTGCG
GGTGGCACAGATTGTAGCAGCTTTGAGAGCAGCTGAACCTCGTTCAGAACAACAAAATCGTTCTTTCCTTCCACACTATGCATCAACAACGTGTTAAAAC
TTCCGTTCCCGAAACAATAACGAAAGGTGCTGCTGAGCTTACCGATCGGAAATCCAAAGCAGATTTCCGAGAAACCAGGCTTCCGACGCAATCCCGGAAA
CAGGAGACGCAGGAAAGTCGAATACTGACAAGTGTAGCCCAGCACCAAGCAGTCTATTCCACAGTGATAAGTTCGTGAGAAGCAGCAAACGATCAGCTGC
TACCACTTGATTCAGCAGCGGCACCGAAAAGACCTGACAAACGAGCATGTTAACAGGTAAAAATAAAAGCATAACCAGCACAGCATGATATCGCCACTTA
CTTCCATGACGAACGCCTCAAGAATTCCGCTTGTCGTCGTGAGAAGATGAACCACGAAATCCACCAGAGCGTTGCAGTACGGCGATTCTTTTGCACGAGA
AGAAATGGGTAGCTGTCCTCGAGCTGATATCAGTCCCTGTCGGACGATCTGGGTCACAGAAGCTCTGGGCATTTCATGGTACAGCAGCTTTCCCATTTGT
TTCGGTGGATGACACAAAAGCAATCGTCCCGAGAGCAAGTAGTGCTGCATCTCCGGCAACGACTCCGTCAATATCCGTACAGTCTTAAACCCCACAGACA
CCTCCACCGTAGATGAAGAAGCGTCACTACATTGCAGACACAAATCAATGAGCCGCCGCAGCTGCCAGTCTCGCTGTTTGTCGTCGCTCCCGTTGAGCCC
GTCAAGGGCAGTAGTCATCGAGTCAACGAACAGCGAACATAACTGCAGCATCCTCTCGGCATCTGATCCACTGCCAGTATAGAAACACAACACGAGACGC
AGCAACTGCAATAAAACAACAAGCACCGCGTTAGACCTCTTCCACACCTCACCTGGAGCTCAGGGGGGTCAATTTAAGCAACATTTCACCTCAAACAGAG
CGTCATAAGGCAGCGACATATTGGGGAGCTGTAAAATGGCTTTCAGTTTGCTGATATCTCCCAGTTTCTGGTCGAACTCGGCTCGCGACTGCGACCGCAA
CCGCCGAGCAACGAGACGTCCGCGCACGAACGCTTGCAACTGCTGCGCCGCCGCCTCGTGCTCCTTGCGCCTGCCTCGCGCCTCCCGTTGCTCTCTCGCC
AGCTGCAGCACGCGCGTACGGTCTCCCCGCCGGCCCCCGCGAGCAAGCTCATTATCCCGCAAGAACATGCTTCGCCTTTTGGTCAGCGCTGTAGAGAAAA
TAGGACCTTTCAGCAATCATTTCAACCAATTGCATTCGATTAACCTGTAGCCATGTGTCAAAACTTGATCCGCTTCAAGTTGAAGAGCTGCTTGCAGCTG
CTGCTGCAGCACTTAAACAAGGTTCACGATGGCGTACAGGATGACACCGCAGCCGATCATCAACACCGGCGTGTCCATCGTATGCGGCGCAGTCGCCTCC
GCGTACGCCATCGTCGGCGCCAGGATCAGCATCGACAGCAGCACCTGCCAGAAGTTGTCGAACGCGGCGTACTGCAGCGCAGGGAACACCAGCCCAGACA
CGAACACGCACGCGCTTCCCTCCCAGCTGCGCGTGTACTTGTTCTTGCTGAAGCAACTGCGCGTCTTGTACTTGTGCTTGCCCCACGTGATGCCCACGGG
CTCCGCCAGACCGTCGCCGATTCCCGTGATGAACACGAGGATGAACGTCAGCGCGCCCTGAGCGGCGAACAGCCACTTGAAGAACATGAGGATGAACATG
CCCGGAGCGATGTTGCCCACGATGATCCACTTGAGCGTGTTCGGGCGATCCTCCGGACGATCCAGCGAGTTGAACTGCAGCATGAAGAACTTGGAGTGCT
CACGGATGGGCTTGATGAGCACGAGGAAGCCCAGCATGGTGAAGAGATCGCCCCAGGCCAGGGCGATCGGGCCGGAGTAGTCGGACTTGATGACCAGCGG
CACCATGTAGGCGGCGAAGTGCTGCAGCTTCCGAGTGTAGTTGACTTTGAACTTGGACGACTTGTTGGTCATGATGTAGCCCTTCTCGTCGACGTCGCAG
AAGCAGCGGCAGATGATACCTCCGAAGAGGGACACGACCATCATGACCACGAGCTTGGGCAGCTGCATGAGCCAGAAGTGCGGGTCGAGAAGCCACTGCG
GCTCGTAGAAGAAGGTGAGAACCAGCATCACGGCAGCGTAGACGACCATGCCGACCAGGAAGGCGAAGTCAAAGGTCCCATACCAATGTTTGCCATAGTG
TCCAGCGACTTCGCCCTCCTCGACCAGGGACGTCTTCGGCCGACACACCAGCGGCAACGATTCCTCTTCAATAGGGACAGCTCCATACGATGGTAGCGTG
TGTTGATGCGGCTCTGGAGATTCCGGTACCTTCCAGATCACGCGCAGCAAAACGTAGCTCAAGACCAAAGCTATCAAGGGCAGCGCCACAAGAACGGTTG
CCTCAGCCGCAGTCAACTCGTGTTTCCAGTGCTTCGGCGCTGCCATTGTCTCATGTACCCCTGTCGAATTCTTGGGCCCTCGGAAAAGGGAGGCCATTAG
TGGTCCAGCAAAAACGTTGAGAGCGATATCTTCCATCTCGGATGCGGCTGACGGTGCGAATGCGGGAATGGCTGGCATTGGTGATTATGAGAGAGGACCG
ACAGCCGCTCCGTCCCAGTAGTGTGCGCACGCACACGTCGTGTCCTGGCCTGTGATTGGGATTCTTTTTCTTCGCACTAGTTCCGCTATCGCCGCTTCCC
AGCGTGTCCCAATCCTTCAGGGAGCCGCCTTTCATCGAGTTGGCCGTGCTGTACTGTAACAGGCCATGACCACGGCATGCCGCTCACATTGTTGGCAAGT
GTTGTTCCTATTCGACTCGTACAGGAGTCACTTTGCCAGTGGAAAGGCTCCGGAGTAATTGGCTACCAGTAGCGGAGAATCGGGAGTTGAAGTCGAAGAA
TCCAATATGGTGGGTGAAGTAAAACTGTTTAGCCCATTGGGTATTTTTGCTTAAATTTAAAGAACCCGCTGAGGAAGTAGGCATTTTTGTTCCATTTTGG
GTGTTTTAGCTGATTACCGCTCCGTTTTTCGGGTTGGAATGCTGCGCGGAGCGAACCGCGCGGACGACGAGACGGACGACGAGATATTGGCTGAGCTAAT
GCGGGAGGGGGAGGATCGCCTGGCGTCCGAGGAGCGCGAGCGACAGGGGCGGCGTACGCGGAACTCGCGCTGGCGGCACTTCATGGTGGCCGTCATGTTC
CTGAGCCAAGTGTTGCTGGAGCTGGGGCGGCGCGGCTTGCAGTGTCTGCAGCGCAACGTGCCGCGATACGTCGCGTTCACGGACCGGTGGCTGGTGCAGT
CGATCCGCGTGTCGGTGTACCCCAAGAAGAAGATCGGCACGCTGCGCCTGCTGCTGGCGCTGGGGCTGGCCTTCTCGCTGCCGTACATCGTGCTCACTAT
CGGGCGGATGCGTTTCCCAGCCGGGCGTGGGTCCAAAGTCAGGTGAGAACAGGGAGCGCTCTCGCAATCGAGAGACGAGTGTTGATGGCCTTAATTTTGT
GTGCAGTGCTGACGAGCTGGACGAAGAGAAAATCCGCTCGCACATTATTGTGGATCGAGTGGACACGCCGGTGCCGGGACGCCGTCAAATGTTCCTTCGT
GAAGGAGGCGACGGGCTGAAGTTGGATCGCACCGATTCTAGGTGTGCGAACACGGTGCAGGGCGTGAAGCTGCTCACAGACTCGATGGGTGAGTCTGCAC
TAGCTGTAATTTTGCTGGACAATAGAGGCTAATGCGTTGTCAAATTATTGTATTTGGCAGGCTACGTGTGCACGCGATCGCAACTGGATAAGATGAAGCC
CGGCTGCTGCAACGAGACCGACGCCAGCCTCCCGCGAATAAAGCAGTTTACGTGCGACCGATGCGATACCAACCCGCCACATTGCTGCGACGTATTCGAG
CACTGTGTGTCCTGTTGCATGCACCCGCTCAACGTACGTTCTGTGTTTGCTGCATCGGCTGCAGTTGCGGCTGCGCCTTCTGCCTGCGTTTTGCTAGCGA
AGCCACCAACTTGGCCCGCGGCTGAGTCAGCGCTCTGACATTGAACTGTTTTTCCTCCTTGTGCTTGCAATCAGTCCGGCATCCGCCGGGACTTCTTGAC
GCACGCTGACCCGAACCACCCGGTGTACAATGACCCAGCCGAGATCACCGTGTTCCAGTACTGCCAGTACCGCTGCCGCACCTCATCCGCGAGCGTGCAG
CACCAAAACTCGTATCGAAGGTGTGTCCTCTTTTTTTATAAGCAAGCGTGCGGTCATGTGGTCGACGCCTAACATTTGCGGTCACTGTGTGGCTGCGGCA
GTCACCGCTCGTTCTGCTACGGGGTCCACCGGCCACTGAAGGTGCTGCCGACCGTCAACAGCGACGGCCTCCACGACGAATGGTGCGTTCTTGTCTTGTT
GAAGTTTGTCGCTGCGTCTGTCCTAATGCGTTTGTCGTCCTTCAGGAGTGGTGCGTCTCGCGAGGGCGCGCGCGGCCACCTCGTGCCGGCGGCGCAGCTC
GAACTCGATCCGTTCTACCA