Description :
From Genome Similarity Track
Location :
Scaffold_36:109453- 111164
Transcript NameFunction/comments
Hyaar_Emoy2805194hypothetical protein

Sequence
1711 bases(100 bases per row)
GTCCAAGTCATGCAACTCCGCTTTCCATTACCACCGGGGTACTTTGCCAAGTTTGACTTGCTGCCTGATGAGGCGCAGGAGCACAGGATGCTCGCGAGCG
ATATCATCCGGGAGACGAAGCGAGATTTGGACCATTACGTCCGAAATGGTCGCAACGTCATCGACTCGAAAACTTGGAAACTCGCCAAGTCAAAGGACCA
ACTCCATTGTTACCGGAGACGTGGCACGGAAGGGTCAGCTCACCAATTGGGTCTGTACAGTGACTCTGGGTCAAGTCGAAGCGATCTCTTCGCCCGGTCG
CGTCAATCAATGAGCTCTCATAGTCATTCTGGACCCACGGACATGGATCAATTGTCGTTCTCCACACGATCGACAAAAGACGGTGAACCAACTCGCAGGA
GCATGCAGCCGTCAGTGATCGGCTATGGGGTCGTGAGTGGCAATGTGGACGACTTGATTTACGGTCTCTATCAGTCGTCCGCGGACGAGATGAAGACGTT
AGCTGCTTATTTGGGGGACAACTCGCTCATTGATTGTGCCGTGTTGAAGACGATCCGGCAGACCCGGTCGTCCTATCTCGGGCTCAAGTGGAAGTTATCT
CGCACAGTGGGTGGCAACCGGGACTGCTGCTACATGGAGTACGTGGGGTTGTCGGAAGATGGAGACGGCCAGCACTTTGGCTACCACGTCATGGAGTCCG
TGCCCGTGCACAACTGTCCTCACTTTGAAGACAATTCGATTGTGCGCGCCCACGTGTCGTTTTGCTTTATCTTTCGACCCGGCAAACTTGCAGACCAAGT
CGAGGTGTTCATGCAAGGCGCGTACGACTCATCGGCTGACGCGCTCACGGCTGGAGGGGTGGGTGACTATCGTAGCACAATGGATATGCTATTTAACCTC
CCTTCTACACTGGTAGGAGCAGAGGCGAAGAAGGTTTCGGCTATGGTGGTGAAACAGTCGAGTGCACACATGAGTGCGAGCACGGTGGACCAAAGCAGCC
ACCACTGCTTTATCTGCCGCACCAAGTCGAAACTCTTGTCCTTGCACTCGAACTGTCAGACGTGCGGTGCCGTCATGTGCGGCAAGTGCCGCATTCGAGT
GGTGACGTTTTCCCGTCGAGGCAAGATCAAAGTCTCGTGCTGCAAATTGTGCATGGTCATGGTGAGAGACCAGTCGCCGTTTGCTGGCGAAGAGCTCGAG
CTGCAGCAGTCCGCAAGTTCGAAGAAGCTGTTTGATGAACAAAGTCGCAGTAGCAGCAGAGGCAGCATCAACGCGAAACCTGATATGATCAACTCGTCGA
TCTCCACCATGTCCCTGAGTGACTCGGAGTACGCCATGTCGTACCATTCGTGGCAGTCGAGTTCCGTGTCTTCGATGCCGTCGGATTGCAGCGACAGCTT
TGACGGCTCGAGCAGCACCTTTAGCTCGTCGATCCTTTCGATGGAACGAAAGATGCCTGCGTTACTGGAGAGCCAGCCTCCGTTGCATGCTCCTGTTAGT
TACCAGTCCGAGCAGCAGCGCCAGTACGAGCAGCAGCAGCTCCAAATGCAGCAATTCCTGATACGACAGCGCATGAAACAAAATGCCGAGGCCGGCTATT
CGACGATGCCGGGTCACTGCCAACAGCCCACCACTCGAGAGGGTCTGTACAACCAAATGCTGGAGCTGCGAGTGCAAGCTGAGCGAGCCTACGACTTGAC
GAACCAGAACG