Description :
From Genome Similarity Track
Location :
Scaffold_61:109422- 110859
Transcript NameFunction/comments
Phyra_81567Peptidyl-prolyl cis-trans isomerase, FKBP-type
Phyra_51635tetrapyrrole (Corrin/Porphyrin) Methylase, putative

Sequence
1437 bases(100 bases per row)
GGCGTGGAGGATGCCGTACAGGGCATGGCTAAGGGTGAGTCCAAGACGGTGGACATCGAACCCGCTCAGGCTTTCGGAGCCGACAAGCAGATCCTCACGG
TGCCGCTCAAGGAGATGAACCTGCCGGAGAAGGAGCGCGAGATGCTTGCGGTGGGTCAGGTGCTGGAGCTGGCTGGTGGGGAGCGTGCACGCATTGTCAA
GCTCTTGGACGACACGATGGACATCGATCTTGCTCATCCATACGCTGGTCAGTCGCTGACCGTGACGCTGGAGCTGGTGGATCACGAGCTGCACTCCGAG
CTGCACGTGGAAGAGCGTCTGGTCCTGCCCGAGGTGATTGAGGAGGGTGACAATGCCACGTTCCCCCAGCGTGGCGACACGATGGTTATGCATTACACCG
GTAAGCTCGCGAGGGACGGAAAGGTCTTCGACTCTTCGCGCGACCGCGGCCAGCCGTTCCAGTTCCAGATCGGCGTGGGTCAGGTGATCCGCGGCTGGGA
TGAGGGCGTCATGCGCATGAGCAAGGGCATGAAGGCCACGCTCAACATCCCGTCGGCCAAGGGCTACGGCAAGGCCGGCGCCGGTGGCGTCATCCCCGCT
GACGCCGACCTGGTCTTTGAGGTCGAGCTGCTGGACATCGTGCGTCACTAAGCCGTTGATTAGACATGCACAGACCGATTGAGTCGTGCCGAAACAAGGC
ACATGTTTGAAACCACAGTGAGTGTGACACATTGTGGTCGAAGCACGCTAATCCTTCATCACTCTACTTCCTCTCTAAACGTCGGTGTTGATCGGTTCAT
CGTCCGACTCGTCCAGGTACGCCTTGAGATCTCCGTATTTGGCCACCTGTCCGATAACAATAATCGCCGGCGAGTACTTTTGTCCCTCCGTCTTCGTGGC
AATGTCCTCCAACGTTCCCAGCAGCAGCACTTGATCTGGGTTCGTCCCGGAATGGATCAACGCCACGGGGGTGCCCTTATCCTTGCCGCTCTCCACCAAA
CTCTCACAAATGCTTCCAATCGTTCGCGTTGCCATCAGCAGCACAATAGTCTCCACTTTCGCCAGCGTGGCAAAGTCCATCTCCGCTGGTTTGTGGCCCG
AGATGACAACGAAGTTCGTGCTCAGCGTCTTGTGCGTCACGGGGATGTTGGCCGTCGCAGGCACAGCCAAAGCCGAGGAAATGCCCGGCACCACCTCGAA
CTTGCACTGATTTCTGTACAGCGCGCGGATCTCCGAGTGCACTCGGCCGAATACCATGGGGTCGCCCCCTTTGAGGCGGACGACAATGTGTCCATGACGA
CACTTGTCCACCAGGACGGCGTCAATGTCCACCTGCTTGGTTGAGTCCTTCCTGCCTCCTCTCTTGCCCACGTACACGATCTCGCAGTCCTTGGGGATGA
GTGCGTACACTTCGGGGCCCACCAGGTCGTCCACCAC