Description :
From Genome Similarity Track
Location :
Scaffold_6:1094157- 1096848
Sequence
2691 bases(100 bases per row)
GGAGCGGATCGGCGATCCTGAGGAACCCGTCGGATCCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTGGGGGCTACC
TCACGATCGAGGTGTTCGACACGAAATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAGTAGCCCTTGCCGAAGTAGCAGTGTTACGTCATT
GACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTTTCCACACTCTACGCCAACGTTCTGTGTCAGAAAGCCGAATGGCAAGT
GGCATAGCGTGCATGCTTTCAACAAGCTGAATGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATG
TACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGGCATGCTCTAGGAGTGGTTGGTGATGCCCCGAGGGCTT
TCGAACGCGCCAGCGACATTTAATCGTCTTGTGAGGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCATACGTACTTCGATGACATCTTTGTCCACAGTC
GTGCGGAGCACGGAAAGACTGATATGGAGAACCATGTGGAGCACCTGCTGGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACGCCAACATTGACAA
ATGTATCTTTGGAGCGGAAGAGATCCCCTTCTTAGGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAA
GGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGAT
GCGGACTGGTGTTGGGACACCGAACATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCTTTCATGCGCCTATTCTGGCTCTGCCAGACCCCGCTCGTC
CGTTTAGTGTCGTCTGTGACGCCTCGGACTTTGTCTTCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGATCCTGTCCATGACAAAGAGC
TACATGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTTCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGGTCATGCGTCGTTACGCACTGCGAC
TCAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGTTGTCCTTCTTCGCGGAGTAGGACTTCGAGGTGAAGTAGAAGTCTGGCAGGCAGAATGTCCTT
GCGGACGCGCTGTCGCGCAGGCCCGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTACCAGATCTGATCCGAACGGCTTATGCCAAGGACG
ACACCTGTGTCACGCTGCTGAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTATTC
CCTCGATGCAGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCTCCGCGTGGTCATCCCTCATGATGAGGACGTGAAGTACCGCATCCTCTATAAG
GCACATGACACGCCGCTGACAGGCCATCTTGACCATGAGAAGGCCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTTTACAAGTGGGCGAGCA
CTTATGTGCGCACCTGCGAGACGTGCCAGCGCGTGAAGTCGTCACCTCTTGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGGGCTGTCGGCAATC
CATGAGTATGGACTTAGTGTTTGGCCTGCCGGCGGACGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCG
GCTGTGCCGGATACCATCGATGGCAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGCCTCTCTGAGTCGATTGTCTCGGACCGAG
ACCCCCGCTTCACGGGCAACTGCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTTGACATGCCCACGGCGGACCATCCGCAGACCGATGGTCAGAC
AGAGCGCGTGAATCGCGTCGTCGAGGACGTGCTCCGCATCATTTGCGCCGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTG
AACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGATGGCCTCGGGC
TTGGTGGGGGGGAGAAGCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGTGTCTGAGT
GTCTTACGACATGTGCGTGACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGGAAGTTATGAGGTCG
GGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCAGCCGTCTTCAAGACGAAGTTGCGCACGCGCTTCATCGGACCTTTAAAGGT
TGTGGCCAAGAAGGGCCTTGCGTACTCGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGTCGTAC