Description :
From Genome Similarity Track
Location :
Scaffold_1645:1094- 3680
Sequence
2586 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTGCT
CGTTACGGAACGAGCATGCTCTCTTCAAACGTCACGCATTGACCAAACGGTCAATGGTGGTTAGACGTGCCGAGACCGGCACGTCTAACCTTGATGGGGG
GATGATGTAACGGGGTTACACGCACAAGTGGCTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTAGAGGTTTGAACACTTCCTCGACCTTGGTG
TAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGTGGTGCATACACATTTAGGATTCTTATTGGCTGAAAGCAGCATCTTTTAGCCAATG
AGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATA
GCAGTTCTCATCTTTTACCAAAACACGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTAACTCAAGTAAAAGAAACA
TACGCTTCCTCATACACGTGCGCATACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCACTACACAAAGCGTCGTAACACCTAAAACC
AACGAATCGTGATCGTCTCCATTTCCAACACACGGTAAACCTTCGTCATCACGCGTCGGGCCAAAAACAAACGCTGTTTCTGCGTCAATCCCTGACGAGA
GCGGAAACTCACGCACCAATTGTTTCAACGATCCCACTGAATTGCGCTCTCCATGTTTCGTTCGCAAATGCTTTACACAGCGAGCGACTTGTTTGTAGGA
CGGCACATCATTTAGCGGTGGAGCTGCGCTGTAGCGGCGCAGACCAGATCAAATGTGCCTGGGCGCGAGCCCCGTTTCATCCATATCGCCAATGTACTTC
TTCATTGCGGGTGTAATAATCGCACGGTGTTTGCCTTCACAACAGGCGTCCCCGTGCGCGTGAGGAACCACAGTCGCCATAATTTGCCAGGTATGAAACT
GTGAGCATTGCCAAACTTTCCACACTTTGCTGCACTGCGGTTTCTTACGTCCGGTTGGCACCGACAGATTTACACAAGTAGCACTA