Description :
From Genome Similarity Track
Location :
Scaffold_210:1094- 2171
Sequence
1077 bases(100 bases per row)
AtaagagcatctccaccgagTATCAGCAAATCTAGCAGCAAATTGGAAAGAAATGCCGTAGTTGACTAGTTGCTGACGAGAGCAAATCACCTTGACCCAC
CGCATACCCTCAAACAGCAACCCCCACCCCCTAACACACAAAAAAAAGCGACCCTTCAGTTCGAAAGAAGAGCAGAGAGCAATACAAGGggcgactcgag
cgacgaagacggcgaggtTAGcagtgacggcgacgatgtcCAGGTACACGTACAGCGTAGCTTACACACAGCTATCACATTCTCATCAAACACGCTGCTG
ATGAATCTAAGCTTTCCTGGTCATGCTTCTCGCGGCACAAAAAGCGCCAATCAAGCGGAAATGTGGAGGATCTGTTCCCGGCAAAGCTGCAAACCTGCAG
CGCGATTTTGAGGCCGCGCACAATAAACTGTGGAATGACTACTTTGCTGAGAGCCCCGTATACCCCGAGAAGTATTTTCGCCGGCGGCACCGTATGAGTC
GAGCGCTCTTTTTATGCATTATGGAAGCCGTTGTCGCTCGGGATCCAGACTTTAAGCAGCATGCGGACGCCCTGGGGAACAAGGGTCTGTCTCCTCTTCA
AAAgtgttgtgctgctgttcgcaTGCTAGTGcacggctgcagcgcggATTCGTTGGACGACAAAATGGGCCGTGCTGAGAGTACAATTCTAGCTTGCACG
AAAACGTTTTGCCAGGCCGTGATTGACGTTTTCGAGGAAGAATATTTGCGCACCCCGTCTCATCAAGACATTGAGCGACAGCTACAAATCTCACCCAGTC
GTGGGTTTCCTGGATGTATTGAATCTCTCGACTGCATGCACTGGCAGTGGGAGTTATGCGCTACTGCACTTAAGGGGCAGCTCACCGGGAGCCTTCTGTC
GTACTTGAGGTGGTAGCCGACAATCGCCTATGGATTTGGCGTTTCTTCTTTGGTTGTGCAGGTTCTAATAACGGTAAGGTCATGTGCTGCGATACCGAAG
TTTTCTTAATATTCAAGAATTGACGgcgtgttgttgctgtgtaCTGTAGACATCAATATCGCGCAGCGCTCTCCTCT