Description :
From Genome Similarity Track
Location :
Scaffold_124:109362- 111081
Transcript NameFunction/comments
Phyin_T30-4PITG_20147Crinkler (CRN) family protein%2C putative

Sequence
1719 bases(100 bases per row)
CAATATTCATAACCACACGGTGTGCGCTAATATGCGCGTCCTCTACTGTTCCCTCCCATAATAGATGACACTCAAACACAACAGTTCTCGCAGACACTTG
ATCTCCGTTGGGGTCCGTGACAGAGTGAGTAAGATTGATGCGCGATTTCTTAGACGAGTTCCATCCAAACCATTTCTTCAGTGTCGATTGCCACCAGAGC
ACACGTTCGTGCAGGTGGTCAAAGTCGATTGCCTTCGTGTTAAAGTCGCCTCCACTATCCACGAAATTGCAAAAAGAGGCAAACGTTGGGTAGCCCGAGA
TAAATTTGATAATCTTTTGAAGATGACCTGATGAGGCTGCAAACAAGCGCGTGGCTGCGTCCTCCAAATCTTCATCAGTCGATAGTTTCCAGCGAGCACT
GAGTGTTCGGGTATCGGCACTTGAAACTCGTGTCTTGCACAAGATTTCTTTGATTGCATTCACAGTCATCCACTGCATCGGCAATCGCACGATCATGAAG
GAGTTCAAACTGGCATCGGGAACAACGTCATGGAGAAAATCTGCATAACCGAGCACCAGAAGATGCAGCTGAGGGACCTGCGTCCACGGCGCCAGCACAT
ACTTGCAAGCGTCCATGAAACGCTCTCGTGATACCACATCTCCACATGGGTCTTCGAATGCCTCACCGACGTCATCCAGCACAACAAACAAAGGCCCCAA
AACACGTACCAACTTTGTCGCAAAATCGTACGCCGTATCGTTCGCGTTCGTAGCAGGCATCGTCCCTGGTTGGAGTAGCTCACTAATTGCCGTAGCCAGA
GCTTCATTCATCGTAGCCTCCAGTAAATCGAGTGGCACTACAAACTGCTGCGGCGTCCCTCGAACAAGAACCGTTCGACACGAACACAGTTGCTTTAGAA
GCTCACGCTGACTGGGGCGATGGTGCTGCGTTGGCTCCCGGCTGGTGAACTGCTGCTGGTTTTCAGGATCTTTCGGCTCCTCGTTATTAAGTGCTTGCCT
GCATTGGTCGATGTACTTCCTTCCCAGTTCCGTTTTACCGGTATCATACACGCTGTCTACCAGTGGAATTTGCCACGTAATTCTTCCCGATCTGTCGCGA
GCCCCGGTGTAGTTAGAATAGTGAACACTCTGTAGCTTCTTAACAGCACGACCGCGTCCCACAAAAGGTAATGTGCCAGTGTTAAAAAGTGAAAACTCCC
ACGTGGTCTCAGGCTTCCACTCCGGGGCAACGGAAACGTATTCGGGCTTCAGCACTAAAATGTGCACGTCGCTGCGGTTGATTGAGTCGCGGGTTGGGAA
CTGAAAATCGATTAGTTGGCAGCGTGGGTCCATCTCATTCTCATCTACCAGAAGTTCCTTCACAAATGGCACAGGCTCCTTCCTTCTCAAACGTTGCGCA
TCACGCATGGTTAGAGTCTGCCATGATCTGTCCGATTTGCGCGCGATAAAGAGCCTGAGAGGCTTCTTGTCGTCGACATATTTCTGGATTGCTCTAGACA
AATCACGGACGCGCACGTCTTCTGTGCTTTGTTGTATCGATATTGTGCCGTCATTGATCACAACGTAGGCTAGCTCTAGCAGTCGCTCGGTGATCGTCAT
CTTTCATAAGATCGAGACAGCTTAGAATCTGGTTTTGATTGGTTATTATGGACATTATCTGCACCAGCACACAGCAAATCATTTGACTTGACTTCTGTAT
GTTTTGAGTCGCAATAAGA