Description :
From Genome Similarity Track
Location :
Scaffold_14:1093523- 1095617
Sequence
2094 bases(100 bases per row)
GATGAGAGTGATGATGCAGCATACGTTATTAGCGCTCTCACAAACCAGCCACAAGATGTGTTAAACTTTGCCAGAAAGCGATGGTACTTGGACTCTGGTG
CTACAAGCCACCTTACCAATCAGAAGCTTGACTTTGTGTCGTTTTCGGCTATGAGTGCACTGGCGCGTTGGTGGAAAGAATTGGTTGAGTGTGGCTGGAG
TAGGAGATGTGAAGAAGGAGATACAAACTTCTCACGGTCGACGAACATTAATACTGCGAGATGTGAGGTATGTACCTGAACTTCAATGTAGTTTGCTTTC
GGTACGACAACAAACATCACGAAGCCTGCCTGCTGAAGAGAAGGTCAGAATCCATTTTGACGACGACAACGTTGCAAAAGTGAAGTTTCAAGAAGGGAAT
ACATTGATAAGACCAATATTTACTGTTTGGAACTGGAGAGTCCCGTTGATTCAGCGATGTTAGTTGCTGTGATTGGTAAGCAAGATGTGAAATTATGGCT
TCGCGTCTAGGACATTCAGGAAGAAGCGTGTTCAATGCATTATTCCGACACACAGATTGGCCGCTGCCAGACACGGATTTACGAGTCGATGCAACATTCA
ATTGCGAGTCGTGTGTGAAAGGGAAAATGACAAGGAAGAGTTTTCACTCGGTTCAAAGTAAGCGTGAATGGTTAGTTGGTGAACGTGTACACATAGATGT
TTGGGGACCATATCCAGTCGAGTCGTACTCTGGTAATCGGTACTTTGTGCTCTTCGTGGATGATGCCAGTCGGTTCTCAACTCTGTTCTTGATGAAAGAG
AGGTCTGACGTCTACGAGAAGTTGGAACTCTATTATGCAAGAGTGAAGACGCAATTGAAAGTGCGAATGAAGGAGATGCGGTTTGACAATGCCCGCGAGC
TGAAAGCTCTTGGAGATAGGTGCAAAGTTAACTACGGAATGGATACTTCGTTGATTGTGAAGCACACTCCGGAGGAAAAATGGAGTCGCAGAGCGAATGA
TACGCACAATCACTGAAGGAATGCGGTTCTTGCTGGCGCATTTCGGATTACCACTACAGCTATGGGCCGAGGCTGCTGTCACCGCTGCACACAGCGTGAA
CATAGTTCCGAACACAACAAGAAGAATGGAAATTCCGTATGCAATTTGGTTTGGAGAGACACCGGCTTATACGAGGCTTCGTACATTTGGTTGTGCTGGT
TTAACTTATGTTGACAGAGTCGATCGCAAAAAGATGGATGCAAGAGCGAAAGAAGCTGTATTTGTTGGCTACTCTCGAGAACAGAGAGGATATCGCTTGC
TAGATAGCAAGACGAACAAGGCATTTTATAGTCATACAGCGGTATTTTAAGAAACCAAGCCGGGCCGAATCATGCTTGAAGATGGCACGACAGCGCCAAG
TGTCCCAACATTGGAGTATTTGAATATTGATGTTGATACGATGCAACGAATTCCATCAATACTCGAAGAAGTGCAAACAAACGATCGGCGTAGGACGGAA
TCTGGAACTGGTGGGGCTATTAGTGAACCTCGTGTTGATTCTGAAAATCAGAGTCAAGAAAGCCGCAGTCAAGGTGAAGCATCTCCGCGAATAGAAGTCC
GAGCTAGAAGTACATCCGAGAGCTCGGAACTTGGTGCGAAATCGACGAGCAAACCCAGAAGGAGAAAGAAACGTAGTGGGAACTGTGTGACACGAAATAC
TGAGTCTGAAACAGAAAGCAGCGAGAGGAAATCGAGGAAGAGATCCAAACAACGAAAGAAAAGTAGTGGGCGGTATGCGATACCGACTGCAGAGTCTGAA
AATGATGACAGTGGGCGGTGTAAGACACCGACTGTGACGCAAGATGAAAAGGGAGACGAGATGCGGAAGACTTCAGCTCCGGCGTTTGGTGAGATAACGA
CCACCAACACGGAGAGGCCTGGTGTGCAGGACGATTCGCAGTTAGAGCGCCTAACCGCCTATAGTCCGCAAGAATTGCCGCGCAACAAGGCACCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN