Description :
From Genome Similarity Track
Location :
Scaffold_109:109347- 110913
Transcript NameFunction/comments
Physo_142168hypothetical protein

Sequence
1566 bases(100 bases per row)
TGAAGCAGCACGTCCGCGATCGTCTCCAGCGCTGGGCGCTCCGGCTGAACGCCTACCGCTACACAATCGAGCACATAGCGGGCGCAAACAACCTCTGGGC
TGACATCGTGTCGCGATGGCGGCCTCAACGCGAAGCGCAGGCCACGGTGCACGCTCGCGCGGTTCGCACGCGCAGAGGAACCGCGGTGCCGGTGGACGAC
CTCTCCCGGCTGCGCCCACTTACGGATGACAACTTCCAGTTCCCGATGATCGACGATGTCCGTGAGGCACAAGAAGCTGCAGGTCGCCCTCCAAAATACC
TTGCTTTGGTGGAGGAGGAAGGATTGCTAGTGCGCGAGCACAAGCCATGGATTCCAAGTGGAGCCACTGACTTGCTCAACAGGGTCTTTGTGGTGACGCA
CTGTGGAGCTCAGGGCCATCGAGGCATTGAGGTACTGACATCTCTTGTCGCCGACAACTTCTATGTTGACAAGCTGGCTGAAAAGGCTACTCGATTTGCT
CGCGGATGCCTGCTGTGCAAACACGTCAAAGGACCGAGGCAAATTCAGCGCCAGTATGGACCAACCTTCACGGCAACTCGACGGAATGAGGCGCTGCATT
GGGATTACCTCTCGCTCGGGGAGGGCTACGGTGACAACGCCTACCTGCTGGTGCTCAAGGACTCACTGACGCACTACTGCGAGCTGTACCCATGTGGCAG
TGCTACTGCCTATATTGCCGCAGAGTCACTGCTTGACTGGGTGAAGCGATTTGGCCATCCCGACATGCTGATCTCCGACCAAGGCACTCACTTCCGCAAT
GAAACGGTTGACCACTTGTGAGTAGCGTCACGATTGCGTTTCGATAGCAGCCTTGTGTAGTAGCTGAGAGGTACATCAAAGGCGGAGACATACACTGGCC
GTGGTATCGATCGGATCATCTCAGGCACCGACCGCACTGGGTAGAAGCTGCGGCGAAGCCGCTTGTTGAGCTGGCGAAAATCACACACCAGTCTGACCGT
TCCATCCTTCTTCGGGATGACGAAGGCTGGACCACTTGTGTGCCCGCCTGAAGATGGACCGCTCTTTCTCTCCGGTGTACACGCCTTGGGTGAATGGGAC
GATTGAGCGACTGAACAAGGACGTGCTCCAAGTCTTGCGCGCACTGCTCCTTGACTATGGTCTGGATCGCCACGAGTGGCCGTACCTACTGCCTGTTGTC
CAAGCGTGCCTCAATCATGCGCAAGTTCGATCCCTTGCCGGACACTCGCCCACCGAGCTTTTCACTGGTCTCAAGCCAGCGTCGCCGCTGGATGTGATTG
TGCGCCAGACCCCTGCTGGGGAAGAGCTGGTCGTGGTTGACCCGGAAGATGTTTCGCGTCAGATCGAGAAGCTGCGTGCGTCGCTCGAAGGCATGCACAA
GGAAGTCGTGGACAAAAAGGAGCGCCGAAGGCTGTTCGACATGCAGCGCAAGAATGGGGCGGAATGCAACTTCGATATTGGCGACTTTGTGCTATGGTCG
CGTATTGACCAGCGCCTACCCAATGACAAGCTCCTAGGCCAATGGCTGGGTCCCTTTCGCGTGGTG