Description :
From Genome Similarity Track
Location :
scaffold_106:10934- 12464
Sequence
1530 bases(100 bases per row)
CAGCTCACATGTGCCAATGACCCCTCTcttccatcatcttcataaatactGATACGTCGGTACTCCTGAATATTCGCAATAAcacaaaagtgcaatgtga
cTTTCTCACTATTGTTTCGGATTCATGTGATACAACTATGTCGCAACTGTAAGATGTAAGTACAAAACTTTACAGTCTTAGGGTACGTACCCTGTTACTG
GTAGGGAGTGAAAATGTGTGAAAGGTCATCAATGGGTACCACCAGACGTTGTGTGCCAAGCGTATTCGTACTCTATCACGTCAAGCTTATAGACAAAGAA
TAGCGGCGTAAAAGCGCATTACAATGCGTAATAAAGGAAGGTCTGGGTTCGTGAATCCTTGCATTCCAGAGCTTTCCCCTGCGTAGTGCATGTGGTTTCT
GACCGTTAGGCCATACGAAAAGCATCGTTGGCGACGTCACTAATTAGCAAGCGACGATATGTAATTTGGGCGACACGAGAATGCATCCCTCAGATCGTTA
AGCCGGCCAGTATAACTTTACTCTAAATGTATACTAGGCGAAGAAAGATGACGGTATTGAAATCCATTCGAGCTGTAaggcgaaaatgtcgtcgtgCACA
ATGACACATGATTTGTATAGACTGCATACGGTCTTTGAATGCGAGCGACGCCTAATTACCAAGTAATAGAACTGTCCATGCATCGTACATATTTCGCTAA
ATCGTCAAAGTCTGACTGCTCTCAttagcaattgataataccCATCGGCCAAGTAAGATGAGTATGTCCATGGCTGTAAATCTTGGCCTTCCAGATTCCG
TTCGAATATttcacgtcgtctgtgacgattTGACTTGTGGCAATGTTTGCGCCTTGAAGTCGGTGGTGAACGCGTCATTGTGTTCGATTTTTTGTCAGCG
TCAAGTAAAGAGAAAAACTACTTGTTCATGATAAACCGCTCCATCTCTAAGTATGGTCCCATCAAGCTCAGGGTATGTCTGCTTGGcataatgtaacggg
gtcagcCCCATTAACCATGTTGTGTAAGCCACATACTTGTGTGTGGTTGACATTTACAAAATATCTTGCATAgttgcatattccttcattCTGTTTTATC
AGAAATAAACGCACTTGTCATTTGGTTTAATGCCTATTGGCCATAATAGATGtcacaacatttttttctcctCGTTCGTGTGAACAAAAGGCTCGCTGGA
ACCGAGCAACACGAAGTGGAGCGCGCTAACCATATATATGTCTTCTTCATTAAGTGCGTGTGTACGGACGGGTCATTTCCATTTAACTCTATAGCAGTAG
CAGTCATTCCAAAGCCGACTACTGCTATGTATTTATCAATGGATAATGTGGACACCACAAGCGGTGGTCGCCCTCAGATCAACAAGGAGGCATATTCTTT
CCTAGCACACTCGCAATGGGAGCGTTTAGTATAGCTACGAGCTTTAATCGGCGATCACACGGTCTTCGACATGTTCCAAAAGCGATAACTTAACGCTTGG
CATAATTTACAGCGTATGAGATAGAATTAT