Description :
From Genome Similarity Track
Location :
Scaffold_329:10930- 14242
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_329-snap-gene-0.21Transcription initiation factor IIB
Pytul_var.sporangiiferummaker-pug3_contig_329-fgenesh-gene-0.5Myosin heavy chain

Sequence
3312 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCGTTAGCAAAGTTTCTCCACTCGGGGGTGTCATCAATAATGCGCTCACCGAGGATCATG
CCGCAGTCTCTACACACGACGTCACCGGCCGAGAAGNNNNNNNNNNGACCTCGCGGCCGTCGTTTTGCGTAATGAACTTGGCGTCGAAGTACTACAGCAA
GCGACACACATGAGCACTATTGTTCTCCATAGAAACAGCGCATGTACCACAGCATATTGACTCTACCTCTGGAGGCGATCCTGTGAGCCACGCCGTAAAC
TGCTGCAGCAGTGACGACGAGAGTGGCTTGAAGAGCGGCACGTCGCGCGTCGTCGACCCCGCGCACGTCGGCAAGTGGACCGAGCCGTAGCCGCGGATCA
CGTCGCGGCCGAGCGCGTCGAGACCGTAGACGCTGAGCACGATGCGCGGCCACCCGAACGGGTTGGTGCTCTTGAATGAGATGTCGATCGGGAAGTTGAA
GATGATGTCGTCCTGCTGGTTCGACGCGTACGCCATCTGAGAGAGACCGGTGTCTGCGCCCTATAAGATACGCATAACCAAGGTGGTGAGGATGCCATTC
GCGACATCCGTAAGACGCAAGTGGTGCTAGTGGATGTGACGCACATGAAGGACGCGCCAATCCGTTCCATAGGTCATCGCATAGCGACAATACAAGTTCG
TCACGCCTGGATACTAACAACAACGTCACATACACAATAGTAGTCACAAATAATAGCGCATTCAGCAACATTAGATCATCGACTATGCACACGTTCAGAG
AACCAGCGTGCATTGCAAACATGGGTAGCGCACGCGTACATCAACTGCTTCAACTTGGCCGCTGTAGATGACGTGAAAGCCGGACGCGGGCTGCGCTGTC
GGCAGCATCCCACCAGCGAGTCTCTTTTCTCCACCTTCTTTCCCATCGATCAACGCAGCAGCGGTGGCGGAAGGAGTTGCTGCGGTCTTCTTGTCGTCTG
CCTTCGTCATCGTAATGCCGACGCGTTTGCCATCATGCGCAATGGCTACGTTTCCTTCCGCGTCGCTTCGAGGCCACTAAGGTTTTTTCATTTTCTTGCC
GCTCGATTTTCTTCATAGAGAGGAATAAAAAACCTTGCGGCGAATCTTCATTGTAGGTTTTTACTAGTTGTGAAAGTTCCATGGAAAACAACAGCAGTGA
TAAAAGTGCTGTGAGTGAGAATAAAACCTCAACATGCGCGGTGGTGGAAGGAAATCCACCACACAGACAAACTCAAAAGTGCAACCTGCAAAATGGACGC
CGAGCGGGAATTGCGCCGCGAGTTGGACGCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCGGACGCCCAGCCACGTACGTGCATGC
GCACTCTATTAGTATATGCGAGTGTGTATATGCATGCGCTGGTGGTTGCGTATGTGTGTGGTGCTACGCGTGTGTATGTGTCACTGGGACTGACGTGCAA
TGGTGTCGATATGCTACTTTCTTGTTGTTATTGGTATTAGGGGCGCGAGGTGGCGCGCTAACAGGCAATCATTCGGCTGGGGACGCGAATGGGAATCGCA
GAAATGTGTTTACTCGACTGGGAGGCCGAAGCGACTCGCTCCGTGGCGCTGGCGGCATTTTGAACCGCAATGGAGATGACAATCGGCGCAATGGGAAGCG
CGGTCTGAACGATCGCTCGGTGATGGCGGCGAAACGTCAACGGCTGCATTCCGCGGTACAAAAAATGGGTGCTTTCTACATGAATGAAGTGGTGCAATGA
CCCTCAGTTGCTGATTCTGCGTGTGGACTTGTTTAGGTTACGAAGCCAGCGGGCGATGGAGACGATGAGCATGATGATGATCCGTCAAACGACAATAACA
GCAAAGCCAGCGAGCGAACGAGACGAGTTGTCGCGCCGTACACGCAAAAAGACACGATGGCNNNNNNNNNNNNNNNNNNNCCGACGCATGTTCGGCGCAC
TCATGGGCCACTTGGGGAAAGCGAAGGCGCAACTCGAACGAGACAGCGATCTTTTCAAGCGCCAGAACTCGAAACAGCAGGAAGCGGAGCAACGTGAGAA
GAATCAGAGCAAGACCCTCGAAGAGAAGGCGAAGCGCGATGCTACGATCCAGAAACTCGAAAAGCTGATTGCGCGAACCGAACTCGATATGGCCGAGCAA
CTCGCTCGCGTGAAGTTGGGACATCTCCAGAGCGTACGGAAAGCTGTGAGTCTGTCGAAGTTCTTGCAAACGGTCGCATCGCCACCCATCTACTACCTGC
CTGCAAAGCACACAAAAGAGACGGATGATCTCGTTGCGGCGTCAAAGGAGGCGCATGAAGAAAAAATGCAGATCCGTACTCGAGAACATCAGGTGCGGTT
ACGCGAGCTGGAAGCAGAGTTTCAGAGTAAACTGGAGAAATACCGCGAGCAGCTGGAAGAAGCAAAGCAGGAAGCCACTAAGAACCCTGAAAAGGCTGAT
GCTGATGGTGAGCAGGTTGTTGAGGAAGAGGAGAAAGGAGAATCCAAGTCTGAGAAGGGAGGAGAAGCCGTGAGCGACGACGAAGCAATGAATGCGGATG
CAGCAGGCAGCAAAGGCACTGAAGTACAGAAGCAGGAGAGCAATGAAAATGCTGAAATGTCGGACGCAGACTCATCTGAAATCAAAACTGATCGTGACGA
TGCGGATAACAAAGATGCAGAAGCGGAGATTCCCGTGAAAGAAGAACTTGCAGCACCCCAGTCTCCAAGTCAGGAGGACGAACGCGATGCCAATGCAGGT
GAGGAAAGTAAACCTAGCATCAAGCCAGAAGAGCAGCCTGCGTCAGCTGACGTTATTGCCGATAAAGAGGCCAGTGGCGAGACAGACACTGTGAAGGAAG
AAGCAGGAGCCTCGCAATCACCAAGCGAGCAAGAGGATCATACAGACGTGAAACCGGAGCCTGTCAAGTCTGAATCACTGGAAACGCCAGTGAAACAAAA
GGTCGATATTTCCAAGTTGAAAGTCACGGAGCTTCGCGAGCAGCTGAAGAAGCGCGGGCTCGACACCAAAGGCCTCAAGGCGAACCTTCTCGAGCGGCTA
GAAGAGGCCATGGGTCAAGAAGCTGCCTAGGCGCAAGGCTTCGAGTATCAGTGTAGATGAATGTAATTGGGGCAGGTGATGCCGACAAAAAGCCGTATCG
CGGACGAAATGACAACGTACCTTCTCACCGTTTTGCTATTTATCACATTCGAGCAGCTCTATTCTCATCACTTTTCGCTTTGTAAGCAAAACAATCATGA
ACTAAAAGAATC