Description :
From Genome Similarity Track
Location :
Scaffold_2269:1093- 2783
Sequence
1690 bases(100 bases per row)
CTGGACGAGGCCTTCCGCATGATCCGACGGATCGAGGCTCTGTTGCTACGTCCGGGGCCGCCTTCGACGCACTCCCAGATGTACGCGTATGGTGCGTACC
CGGCGCACTCAGCGTACTCGGCGTATGGCTCCGGGGTCCGTTCGTATGGAGCCCCTCCCGTGTACAGTCTTGACCGCAGCTTTGCCGTCTAGACCGAGGC
TTGGGCGCCTCCTCCGACGCCCTCGTCGACGTCTGTCACCCGCCCTCGCTTTGAGGAGGTGGGTACGCGAGTCAGCAACCCTCTGCGGATCAAAGTACCG
CTTAAGACGTCCCACATAGAACGTCGGGTGCGTCGTCATTGGCTTAGGCAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAATGGTCCG
ATGAAGCGGTGCTTCGGATTGGTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGTCTCCCACTTTAAATACAC
TTAAGTTTCCTCTTCCATATTTGTCGGAGTACTCCTTTTGGCTATCCGGTGCGGCTGCCATGGTATCGCGGACCCTGCTGACAACGCTCAGCTTGGTATC
CGTAAAGGAATCCACTTGTTTTCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAATGGCTTTCCGAGCCTCTCGCCACTTAGAATAGAGGAAT
TAGTATCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAGCCCCGTGGACGCGTGCACCGCATTGTTGAGCGC
AAACGCAACAACGGGAAGCTGCGTCGACGACGTACGTGGTGGTGCCGCGCACACACTGCGCAGAGTGTCCTCAAGCACTCGATTGACGCGCTCTGTCTGG
TCGTCTGTCCGCAAGTGGTCCGCAGTTGTAACGGGGTTACATGGTGTGGAACACACAGGTGTACGAAGTACCCGGAGAGTTAACATACTCTCAGTACATA
AGCTGGAGAGCTAACAAGGTCTCTCAGTACGTTGGCTGAAAGCCACACGATATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAGCAGATACATTT
ACCCCTAGGCGGCTTGGCCGCAATAATAGTAAATAAAACACTTCTGGTTTTGAAGCATAAAAGTTAAGGTATTAACTTTGAGCCCTGGTCTGGGGCTGTA
AGTTCCTTTGGGTAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTT
GTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCACTTACT
AAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACCGCCAGGCTGGAATCGTTCTCCCGCTACGAGA
ACGCGCTCTTGGAGCACGTCCAAGAGAAGATGAGTGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAG
CGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATGGGATTGGCCCTGCTCCAGTC