Description :
From Genome Similarity Track
Location :
Scaffold_1006:10928- 13340
Sequence
2412 bases(100 bases per row)
AAGAGTTGGCAGCTGCCGCTAGCTGGTGATGTTGTTTGGATCAAAGTTTTCGGTGTTTCAGGTAAGCGTTTCGTTTGGATGTTTCGCTGCTCCGATTTGC
ATGAATcgcaagctcaagaaagATGAAACTGGGTGCCCCAGCGCTGCTTCAGGATGTAGTTTTCAAGCTCTCTGACGAGGATGGCCGCCCTAGCAACTGA
ACtcgcttcgtcgactgttaAACAATCaagtcacttcaacttcaacttatTTCCCAAAACGCCTCCACACACATTCGATTACAGTACCAAAGTCATTATC
TTCCTGCCGAGTTGGAGCAGCGCCGGATAGGCCCTACAAGTCTAGGATGAACATtctggctgcagcagcacacgccCTAGTTCGCGCAACCGATTGAGCA
TCGCCGATGCCATAGCGCTACACCTCGAAACTATCGGCAGtgcacgtacatgtacatgtatcgtgAAGACCGCAACCTTGCATCAGTAGTACTGTACTTC
AAGCGTCGAACTCATCACTGCCGAGTTCGACGTTGCCCAAGTCCTCAAGTCCTCGGGTGGGTGCATAATCGTCAATACACCCACCCGAGGTCTGTGCTAG
CTGGCGGCCCCTGAGCCATCTCATGGTTGACCCGGGCTTTCCTTCTGGAATTCGTTATCCAAATTGTAGCCAGTCGAGGTTGCGCCACTCGACCTTCTGC
ACTAACTTAgggtgctggtggagtttGAGAAATGGCGAGCTTCTCGCTCGACAAACGTGCAGCATTGCTTTCCGGGGGATGCCAATGCGTTTTTCTTCCG
ACAAATGCTGtatggatacatgtactgtacaagCACACATGCATAGCAAAAGGCTCGTAAACTCTGAATGCCGACGCGCTCTGCGTGTACGGAATGTACC
GCGCCCTTGAAGTTGGCGCGGTTCAGACATTTTAATGCATGTGTACACTTTATGGCCGGATGTACGGATTATCCTGTCaaccaagaagcagctttTACCT
GGAAAAGAGATAATCATGGTGCTCGAAGCTCACTGACATGCCCGATCCAAACGTAAGACGCCTCTATGTAGTGTCGACGCCGAAAGAGGCCAAGTCGCTC
TGGAGGAATGTCTGTTCTGCAGTCTGCAGTCTGGGGACTGTAACTTACAAATTGCGAGAGCAACTCATTATTTTATGCCCTGGGAGTAAAAATGAGTTGC
TGGTAATACACAAAAAGGACAATTGATCACCAAGGACTAATTCAACGCAAATCCCCTTCTGCTGTGTCGGTATCGCTCGATGGCGTTGCTGGTAGCGGAC
CCTTTCACCTCTACCTCTTTGGCACAGAGCACCTGCCTGTCTCGGAATGCATTTGGTATGTCTCGAGAAAAATGGTTCTGTTGCGGAGCTAACGTCGCCG
CTGAGTGAGCTCACTGAGCTCGGTCTCGATGTGCAGGAAGGAAATCAGAGCAGATCACTTCAACCTGCGCCTTTGAAACGTTGTGGTGAGTGCACAGCGC
TCAACGAGGCTCATTGCTCATCAGCTAATTACAATCCCCGTAGCGTGAATCACGCTGCGAAGTGATGCGTCTTCTAAGTGTTAAATCCAGCGGAAAGAGA
GCATTCACTGCGTCTTTCCTCTTTAAAAAAATCCTACTGCTTGTAAGCGTCGTTCTTTAAATTCGTAAGGTCGAATGACTTTGATCGTACAAGGTGGTCT
CGATCGTTGTATAATAGCCACGAAAAATGCAGTCTGCAtgtaggtacatgtacatgtactgttcAGCATTGCGGTTCCACGCTGCGCGCGGACCGCCGGA
CACTGACACAAAGCAACCTGCACGCTGAATTTGTGTCGGCCTCGCCGATCGCGCTGCCCGCCGGATTTGCTTGCGAGACCaaaaaacttcaacttgaagt
gtTGAAGCGCCTCCACTCAAACCTGATTGCCGGCAAATAAATGATGCCCGACCTTCGTTACAAGCCGCAGGATTTGGGCTGAGAAATACGAACCCTACGC
GGCGCACAGCTGGCAAAATTGAGCCAAGACTGCCGTGGTTGAACTTATCTAGCAAGAAAACTGAGCTTTTGCGATGGATCCTCAggaacgccaagcagcg
ctcGCCAGCTGGTTCAGAAATGAGAGCCCTGCTCAGCCAAAACTGAAGTGAGCGGAAGATAATGTACAAGTATGatcttcaacatcgagtGCAGCTTGAA
ACGCTCCAGGCAAACCTCAAACCTTCTTAGATGTTGACACATTTTTCGCAAAAAGTGCACtgattacatgtacattatCGATCTGCGTCGAGACAATTGC
CGCAGACATCATCTGCGGAACCTATTCGACGTTGCACATAAATTTACTCGCCAGATGGCGATGGACGCGACCGAGACCACACCAACGTCAAGGTCTCCAC
TGTCTCCCCTCT