Description :
From Genome Similarity Track
Location :
Scaffold_331:10927- 16206
Transcript NameFunction/comments
Hyaar_Emoy2813780gag protein

Sequence
5279 bases(100 bases per row)
AATATCGATGTAGCCTCGCACGTAAACGTGCCGACAATTCTATGTCCGAGTCATTAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTC
ATCCTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGCGTGGTGACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCGTATCAGCC
AAAGCATGTTCCTTTCCTGGCTAATACTTTACTTCAAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGCCATTCTCTGAGAGAGATGCGGCGACTGTG
TCGCAGTGCGCAATGATGCATGATCTGTATAGATCACAAATGGCTTTGAGCCAAGCAGATGTACTCTGAATTTGGCTAGAGCGTACTTCATAGCAAGTAG
CTTTTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCAATGACGCGTTCGCGCCCATCGACATCTGTTTGTAACAGA
GCACTGCCTATGGCAAAGTCAGATGCGTCACAGACGACGCTGAAAGGACGATCAGGATCGGGCAAAGCCAGTATTGGCGCATGAAGGAGGCTTTCCTTAA
CTGCTTGAAAAGGTTCATGCTCAGTGTTACCCCAACACCAATCCACATCCTTCTTAAGGAGGTTGGATGATGGCCAAGCCATATCTGCGTAATTCTCACT
ATACTCATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAGATCTTTTTAGTACTTTGGAACCAGCCAATCGACTATGGCCCTTATCTTAGCGGGGTCC
GCTCGAAGGCCTCACTTCCCAATGAAGCACCCTAAAAAGGGAATCTCGTCTGCACCAAAGATGCACTTGGATGCATTTGCATACAATTTATTCGTGCGTA
TACACTCGAGCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGTCGTTGCACGACTATGGACAAAGATGTCATCAAGTAAGTTTGTG
CATAGCCTCGATGAGGTCTGAATAGTCGCGTCACCAGACGATTAAAAGTAGCCGGGGCATTTGACAGCCCTTGTGGCATAACGGGCCACTCCCAGAGCAT
ACCGCTCGGGGTATTAATCGCTGTTAGCGAAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAATTCGAGCGCACTGTACAATGTACAT
CCCACCATACTGTTCTGAAGAACATCCTATCTGAGGATTGGCGTCTGAGCCGGGATAGTGGCAGCATTAAGCTTATTATATGCGTGCACAATACGCCACT
TACCACTAGGCTTTTTGAAACAAAAAGTAGGTGTGGAATGGGGAGACTTACTCTCCCTCACCATTCCCGCCCCGTGCTTAGCACGAAAGAAATCGTCAAT
GACGTCACACTGTTCCTTATGTAAAGGCCACTGCCGTGTTATGCAGTATTTAGTTCTTGGAACTAGGTCAATTTCATGACGTACACTCTATCGGGAGGTA
AGATAGATGGTGGATTGTGACATACCACATCTTGAAATTCCTTGACCAAAGGATAGAAGGGATCTAAAGGATCTTTAAGGATCGAAGATCCACTCCGGGC
ACTGAGTGCCGCCTTGATGTCCTCTAGGACCGACTCATCCATTATTGAGGACGAGTTCAACTCAATATCGGGTCTAATGACCACTAATTCGGATAAACCT
CCTGCCTTCAAGACCTGGCTAAACTCGCCATCAGACATTTCGTCTAGCTCACAAAGAGCATCCAAAGATGGAAGGTTTTCCAGGCTAACATTGCCCCCCA
CCTGGCCAGTCACTCCGTTGACAAGTGTATATAGTTTATCACTATTGTCACTATGTGACTGCAAAGACGCCTGGCGCTTAACAGTTGCCACCTGGCGTCC
TGGTCGTCTCTTCGATGAGACGTTACACCCCTCTGGGGTCGGGAAAATAGTGTCCCCGTGGTTACTACTAGTAGTAGTACGCTCTGTACGAGAGCTGATG
TCTTGATCGACATCCGGTGAAGTGTTAAGTAACTCGACCACCTTACCCAGTGGATTTAAAAGTGCCCCTGTACTTACATTATACGGGCCTAGCCCTGAAC
TTACTGGCATTCCGCCAAGATTGTCATTACCGACATTAAGTGTGGTGCCTTCTCGGCCGACCGCACTCGGTGCATTTTCACGTGCCACTACACACACATC
AAAGGAATAACATCCTTGATAACTCGGCCCTAGGCTAACCATTCTTCCAGCATGCAGTGACTCGTTATCACAACGAGTAACACTCAACAGAGTACGTGCC
GTATCACTAATATTCAACGAGCTACGCTCGGAATTCATGGTTTCAACATTGGAGTTAGTTAACTCAGACATTCCAATGTCCAGCACATTGACATCTTCTG
TCAAAGGCTCGCGCCAATAGTGCTTTTGCTGCCAAGCACAGGTGGGTTCATGACTCTCCAAAGCTTCGCTAGAAACATTGCGCGTAGCGCCTAGGGTCTT
CGACCCCAATCAATCCATGGCTAATGGCGTTCAGGCCAAGCCATATCTAGGATGAGATCATATCTAGAGTCCAAATCAAGGACAAGACAGCGTTTAATGC
TATCAAAGTCCAAGAACTTTATACCTAAGTTCAAAGGAACTTTAGGTACAGTGACACGACTTCCAGTCGCTAAACGAACCGTGATGGAATCACCCTCATG
CGCTGTAATCGCTTCAGCATAAAGCTGACTTCCCTCAAGAGAACGACGTCGAGCATAATTGCAAGACGCCCCAGAATCGCTTAAAATTGACCAAGGCTTT
TCAGAGCCTTTAACTTTCGCCTCAGCGACCAACAATCCATACTTGTATCCACGCTCCATACCTGTAGGCATGGAACTCTTTGAGGCTAAGCCCTGTTCAA
CTTTACCTCCTAAAGGTGTTACAGAACTTAGTTATTCCCCAATAGGGCGCCCCGCGCGTACTGGGTGTCGGCATTTCCCCGTGCCATGCCAGACTTCTGG
CTCGGGGTAGAGTGTTGGCTCGTAGCCTGGCGCTGTCTACGCAAAGGGCAACCAGGCCGCAAGTGTTTAGTGCTTCTGCACGTATAACACCGTCGTACAA
CACGTTGCTGCTCAGCAGCTTGAAGTTCAACTTCACCTTCATCTTCAGCATAGCTGAGATCCATCGATTCTGGCTATCACCGGCTGGAGTACTTGTGGAG
TTTGCTCTCGCAGAGCTAGGGTTGTACCCATTCCAGCCAAGTCTGGCCGACTTGAAGTTATGCTCAGCAATAAGAGCAATCCTCACAGCCTCTTCGAATG
TAGAGGGGTGAACCCGAAAGACTTCGGTTCTGGCAACTCCAGTACGGAGACCCTCCATGAATATAGTCACATGGACTGCCTCAGGCAGAGGGTTAGACTG
CATAGCAGCTATGATTCTCAATTCTTGGACATAGTCCGTTAAATCATTCTTACCCTGACGGGTTAATAAAAACCTTGAACGCACGCCGTAAGCCTGGTTA
GGTGGTGAAAACACCTGTACCGATTGTGACTTAAGCGACTCCCATGTGGGAAACGCTAAGTCGACCGACGTGCTACACGTCAAGGCCCATTCTCTAGCTC
TCCCATCGAGCTTTGAGATAGCCAGCGAGACCTGTTGATGGTCAAGCTTGATCAGGCCTGATCTCATGGCCATCTCAATCTCACAGATCCAGAGGATGAG
GTTTTCACCCTCCTTTCCTGAGTAGTTTTTAACTTCCACTCTAAGTGGACTAGGCCTAGCCTCTTCGTCTGGAACAGACACATACCGTGTAGGCATAGCC
GACGACATTTGGTCTTGGACCTGCCCTAGAAGGGACGCTTCATAATGCAAGAAGCCCTCAACACGTGCAGTCAGCACTTCCAGGCCTTGCGATACAAGGA
ATTTCACATACTCTGGACCCAAAGATGGGGTCAGCTTATCAAGCGCGACCTTTTGGGCCTCAGAGAGGGGAGTGGGGTTTTCCATCCTCACAGAGAATCA
GTCTTTAAAGACTCAGGCGTAGATTGACTACGAGTGCTACCAAGTATAGCGGAGCGACACAGCTCCTTAAGGCAGAGGAAGACTTAGTGCTCAAAGAGCG
ATGTTAGTTCTAAGGAACTAAACTCTATGAGTCAACAATCGTAACGCTTAAGATCCCTGTTCCAGAGGACCGAACGATTCAGTGAATGTACAGCACTTAG
TGCTCAAGAGTAGCTACCTCAAAGAGAGGTGCTAACTCTTAACGATCAACGATCCGAGACGCCTCGCAAGGCACGTGTCTTAGACAAGATCAAAAGGGGA
ACTGAACTTTATTTACGTTTAACTCTATAGAATATCTAAATTCTAATATTACCTAATCTAAGCACTCATATCCTAAATCAAGAACTTTCGAGATCTTTCC
TATCTCGTGGCTGACAACCGTCAGCCTCGTATAAACCGAAAAGATATTCTATTTCTCTTTCAGTGGGATAACATTCCATGTGTCTAAGACACAGGGTACC
GAGTACCCTTTGATGTGTAACCCCGTTACAGGAGCGGTTCGCGAAGGGAAAATAGCTGGCGCGGCCTCTACGATAGACCATATGCTGATCTTCCTGTCAA
AATTTCCTTCCCTGTTTGAGTATTATCAAGGGAACGCGACCGCGGTCAAAACTATCACCTTGCTGATGTATAATTTGTGAGGTGTTGAGCAGTATGGAAA
ATTTATTTCCGGAAAGTTACTAGCTTGTCGACGTCTTGTAGCAATCGAACCATTCGTCGTATACATTAACGACATCACACATCGGTTTGAAAATAGCAAA
TAAATTAACCTGTAAAATGATCACTCTGTGTTAGTGGATTTTTCAAAATGCAATGCAGTACAAAAGCTATCATGAGCAAATTAACCTACCGATACTGCAC
ATGACTTAAGGAAACGCGAGTTGCTTCTGCTTGTGTATAACTTTAAACATTAGCTTCTCGCGTCAAACGAAGCGGCGCAAGACGCCCGAATTCACATAGT
GGTGGATAGAAGACTTCTGTACGTCGGACTCGCTTGATATATCTAACAAAGTCTGTATCTGGTAGACAGGAATGTCCTGAACCGCAAACGCCACCTATCT
CGGCGACTGCGCTGATCTTTGAGTGACTGTTAATGGACAGGCGATGATAAATTACCGCAGATGGCGCATGCGCCATATAATGTTTACACAGACGATCAAC
CGAGCTGAAATTTTGCCATCCATGCTTAAACAGTGCTTTTCGCCGATCATTCGTCTCTGTGTGTAAATGCTCAGAAAAA