Description :
From Genome Similarity Track
Location :
Scaffold_341:10926- 13919
Transcript NameFunction/comments
Physo_144934reverse transcriptase
Physo_125680hypothetical protein

Sequence
2993 bases(100 bases per row)
GATGTGGCGATGGAGTCCGTGAGCTCGCGTCCCTCGTCGAGGTCCGGACCTTGACGCGACGTGGACGAGGACCCCCACGATCGGTTTGACGTGGACGTCG
GGACGCCGAGAGCCGCGGCCGCGGTCTCAACCGCGACAGCCGGTGTCGGGCTTACGAGAGTTCGCCTCTCGGCTTCATCGGAGCTGAAGGAGTTCTCGGG
ACGAGATGCCGGCGAAGAGAAGGCTAGGCTGTGGCTCAATCGTCTGAAGTCCGCTGCGCGTCGCGACGGGATGACCGGGGAGGAAGTGTGCGGGCTGTTC
AGCGATCTGATGAGCCGCCCTGCACGCCAATGGTATCTTCAGCTGCCCAAGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTCCGCGTTCAGT
ACTGCGGCAAGGGCGTGTCAATGGCCAGCCGCTACTACCATGCGGCTCAACGCCCCGATGAGACCCCTCTGGATTACTTGTACCGACTCAATGTCGCGGG
CTTGAGGGTCAACATCCCATACGCCGATGGTACGACTGAATCGCGAACACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACTCGCCTC
GCGTCTCACGCTGATGGAGGTCGCTGACTCTGAGGCGCTGGAGAAGAAGCTGCGCGCCCGACAACGTGGATTGGCTCACCAGAAGAAGACCCTCTTCGGC
TCGAACAAGTTCCGCCAAAAGGCGCCGACTCCGCCGACTCAGCCGGCGCGCACCGTACATGCGATTCCCGTTGCGTCAGACGAGTACGACTCGGAACGCG
AAAGTCGCGACACGATCGCCAGTACGACCAAGACGAGGAGGACGAAGAACGCGCCAGGTTGTTCGTCGCGGGGCAGGCCCCGCCGGGAGAGCCGGCGCGT
CGCAACTTCGATCCTGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTCGCCATCCCGAAGGAGACTGCTGGAAGTTGTTGACGT
GTCAGAAGTGTGATGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCCCGATGGAGGAGTT
CTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGATGTTAAATTAGGACGCTCGCTGGCTTGGA
AACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACGAAGTAGTCGCGAGAGGTGGTTAGTGAGAGCCCGACTTCCCTGAATGATAATAC
ATGTGAATCCAACCCGGAACGTACCACGCAAGAACGCGCGCCGCGAATCTCGGCGGTCCGACGTACGACGGACGACGAGTTTGCACGTGAACCACCCCTG
GACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAAAGCTGAACA
ACCGCCGTGCTGTGTTATTGCTCGACACAGGCGCCGAGGTGTCCATCCTGGACACCATGAGGTAGGCTGCCTGATCGACACAGAGATCACGCAAGAGTGT
GTGGGAATTCGTGATGAGACATGGGGAGAACCAGAGTCAAGATTACCTTGGCTGGGAACTTGGTGTACTACATGCACCTGTGGGTCGGCGACTTGGTCGG
CCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACACTGCGGACGGCACGGCGTGCCTCCCCGACGAGGTGCATATCCAG
ATGATCGGACGAAGACCGCTATACGGCGCACGGACGCACCCGGTCAACGTCAAGACACCTGTGAGACTCGAACCAGGAGACACGCATGAAGTCTTGCTGA
GGCCGGATCGAAACGCGCCGTTCCTGTGGATGACACGGGCAGAGTCGTGGGTGACTACCTTGGTCAAAGGGAGAGTCGGAAGGAAGACGTACCTACGTGT
CACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTGGACGCCGTCAGACGGCCAACCTCGGAACCGTGGATTCGTCCGA
CTGGGCTCCTCCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGTGCGACGCGGAGGAGAACTGGATCCCAGCCGAGCTCGACGGGCCGATGA
CGAATCGCCCCTCATACCCGACGCCTAAAGCCATTTTGCGCCCGGAGCCGAGACAACTCGGGACGCGACGCGCCGTGACCCCAGTGTTTGGCGGCTGTCG
CGAGAGCGCCGAAGGGAAGCGGGGTAGAGGTGCCGCCCGACGACCACAAGCAGAAAACGGGCGAGGAGGCGGTGGAAGTGGAACCCGATGGGCCTCCGAC
AGTGGCTGGAAGCGCTGCGATGAAGGAATCGCCTGAGTCAAAACTCGCCGAGCCAAAACTCGCCGGACCAGAACCCGCCGAGCCGGAACGCGACGAGGCA
AAACCGGATGAGCAGGAGGAAGACGATGCAGTCCTCATCCACGAGGGATCTGACCTCTTCGCCGAGGAGCTCGAGTCCGAGATGGCAGTGCTGCCAGACC
TCTCGCTGACCGCCGAGGTGAAGATCGAAGACCTGAAGGTGGGCGTGCCGACGGGACTCCCGCCCGAGGAAGCCGCGAGACAAGAAACGCGGCTACGCCA
AATCATCTGGAAGCGACGGAAGTGGTTGATCGGCAAGGGTAACGCCTTGCCACCAGCGGCCCTGGGAGTGGTCTGCGACATCGACGTGGGCGACGCAAAA
CCCGTCGCGCAACGCGTCCGAAAAATCCCGCCAGAGTTCCGAGAGAAGGTCGCCGACTTGATCAAGGGACTGCTGAGCGCGAGGATGATCTAGAAGTCGA
AGTCACCGTGGGCGTCGCCCATTGTCGTGATTATAAAGAAGAACGGCGTCGATATCCGGCTCTGCATTGACTACAGGCTCATCAACGCCCTGA