Description :
From Genome Similarity Track
Location :
Scaffold_785:10926- 13245
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_785-fgenesh-gene-0.3Flagella-associated protein FAP196

Sequence
2319 bases(100 bases per row)
CTCGATAAACGCGCTGTAGATGTGTCCGAAGATTTGACGCCACGGCAACAGTCGGCTTGCGTCCGGAATCGTCGAGTCGCCTTGCTTCAACAACTCTTCG
TGAATCGGAACGAGCAAGCCAAAGAGCGACTGCTTCAGCTCGTTTGTCGACACACCGCCGGAAGTAGCGATTCGGTGAGAGTATAACGAATCCACCAGCT
GCGAGATCTGCTCAAAGTAGACTTCGCACACCTTGGACGGCGCCAACGGAGCACCGTTTGCAATAATCTTGTGAGTCGTGAGCGTCTTGAACAGTGCGTC
CCAATGTTGCTGGGCCTCGCGTGAGTTCCACCCATACACCGGGGCGTTGATCGTCGCTTGTAATTCTGGAATGGGGATGTCAGTGTCAATGACAGACGGC
AAGAACAGCGCGTCCCGTAGCTTCCATAGTTTAGTGTGAAGTCGATCTTGAATCTCCATCACGCCTGACGTCGTCTCGCTCCGCTCAAGCAATGCCTCGT
GCACGGCAGCGTCCATGATGTCTGCCAAATCAACCACCTGACGACCTTGGCCTGGTTGCGAACTATCAGTACTGGCGAGTTTTGTGAGCACGCCGGTGAT
CTTGTCATTCACCACTTCACTGGAGAAGAGGTCATCTTCCAAGACGAGTTCGCCGTCGATAAATGCAACCTTATCTTGGTTGTTGGACATGATTCGTTGG
ATAGAAGCTTCGGCAGCCGCAAGGGCGTCGCCTCTCCGAGCCGTCCGCGACGCACAGAACCCGAGAACCATAACGCCGACTCGGCGCGATGGATGGACAT
GCACGAGTACAGCTCCCACGCGCTCCTCCCAGCGTTGCAACTTCGTAGGATCCAACGCATGACTCAAATCGAGTGGCAACATAATCGCCGATGTTCCCGC
CAAACGCTTCTCTCGACCATGTGCGCTGAGGCTCTGCAGAAAATTCGCACTCAGATACCGGCAGCACACGCCGAGGTTGGACGTGTCGGACCACTGCGTG
CAGAACACGGTCGAGATGTTGTCCTCATCTTCGATCAATGCCGACGCGATTCCACATTTCACTGCGCACCAACTGCCAAATGAAGACAAGCCATCGTCCA
ATAGATCGGCCACGACAAACTTCCATCCTGTGGCATGTTGACCGGATCCCCTCGCATGCTGACCGACAATGGATGCGACTTCAAGCGGTTGCCATAAGGT
CTTCGGTGGAGGTGAATAGCCAGCATCGCTGTCACGCGAATACATGTCGAATTTGCGACACTGAGTTCCGATGAAATCAGCAGCTGAGCGAGGTCCTCCG
AAAAGCCACTCCATAACATCCGAAGGCTTGGTTGTGCTTTGCTCCACAAGGGATGTTGCCCCCATCTTAACGTCTCGGGGCAAGGTCTTGGATTGGGTCA
CAAACTTTCTCCACACGTGGAAACGCAGTCGCATCACCGCAAGCCGCTGCTTCTTGATGCGCTGGGCTTGCTTGCGACGAGCAGCTTCCAACGCCAATGC
AGCCTGCCGCTTGGCTTCACGCTCAAGTCGCTCTCGCTCAGCGGCAAGCTCCAGTTGCCGACGACGTTCTGCTTCGGCAGCAGCTTGCCTCCGCCGTTCC
TCTTCAGCAATTTGCAACTCGCGCCGTCGCTGCGCTTCCTCGGCTTGGCGTCTCTCCTCTCCCAATCGTCTCGCTTCAGCTTGACGAGCTCGTTCGGCCG
CGGCCTTAGCCGCCTCTGCTCTTTGTCGTTCTTGCGCTTCGAGTTCAAGTTGTCTCGTTCGTCGAGCTTCTTCTTCAGCCTGCTGTTTCTCTTGGAGTTC
ACGCTGTTGCCTTGCGATTTCAGTCTCAACTCGAGCCTTTTCTTCTGCTTCACGTTTCTTCGCTTCTCTTGCTGCACTCTCCGCCTCGGTCGCCTGACGC
TTCTTTTCTTCTTTCTCCCGTTCAAGCTGCTGGATACGCTCCATCATCTTGATCTTGGTGAGTTCGACTTCAGCTTTCTTTCGCGCAATCGCGTCCAGCT
CGTATTGACGCTCATCTGGATCCGCTGTTGACAGCGTTCGTGGGTGATGCTGGATCGCAACCGCTCTGTGATGATCAGGAGCGCGTGTGCTTGCCATTCG
ATCACTTGAGTCAAACGGGTCGCTCGTGTACACCGCAAAAGCTGAGTACTCGTCTTCCTCAACTGGACGATCCGGATACAGAGCCAACCGCTCAGCGTTT
TCAGTGTCTTCAATGAGCTTGCTCAGGGGAGGATAATCCTGTTGCTCATACTCGGTCACGCCGCGACACACATCTCCTCGCAAAAAGTCACTGAACAATA
ATATCGACAAAGTCAGCGA