Description :
From Genome Similarity Track
Location :
Scaffold_263:10926- 12650
Transcript NameFunction/comments
Phyta_totarag6376hypothetical protein PHYSODRAFT_478939

Sequence
1724 bases(100 bases per row)
TACAGCACCAAGCTATGGGACGCCCGGCCTTCCGAGTACTCGCAGAACGTCATCAAGAAGgtctgcgtcttcatcttcgtcctgaCGATCTGTGAGGAAG
TCGCCAGCTATGCTGTCAACCAGTCGCTCAAGAACTTTTTCCAGCGGTTGGGCTGGTCCAACAAGGGCTCAAACTCCATGAAGCTTACTTACGATTCGCT
GAGCCAGTTCGCGTGCATCCTCGCCGGTTATATATCGGATGAATTCCTCGGCAAGTTCAAAACGCTACTTGGAGCTGCATCCTTCAGCTCCGTGGGGTTC
GTGCTTATCACGCTCGCAGCGTTACCGTCAATTCGCGCGACGCAGTCTTTGAGTAAGGCGCTCTTCTGCACCGGCCTCTTCGGGGGGGTAGCGCTCAACC
AGGTGTGCCTTCGAGCGCTGACAGTCTCATTTGGTGGTGATCAATTCTCGACAACCTCTCCTCTAGACGAGCGCGCGAatttcttcagcttgaactTTTG
GGCCTCCCGAATTGGCATCTCCTTCAGCTACGCCGTATTTCCTTCCCTCGCCATCCATGGCTTCGGTGCCATTCCAGCCGACTATGGTTTCGTAGCTGTC
TACCTCGTCGGcctgctcatgctgctgatTTTCGTCGGAGTGATGCTGCTCACGCGCAAGCGCTACGTGGACGTGCCACCCACAAAAAGTGCCCTCGGCA
GTGTGATCCGTGTTGTTGTCCGTCGCGCGAGATATAACTTCCAGGCAAGGATGATTGTACTTGGCACTATCATGTACTTGTCTGCATTTCTGCTGAATTT
TCCTGCTGCATTTTTGGCGGACCACGGCGAAGTGGGGCATAACATTTCGTACGCGTGCGGCGTGTTAACTGTCGCCGCCACCATCATCTACATCTACTAC
GCTCGGAACTCTTCTTTCATTGATGGCGCCACGGATGCTCTCGGTGTCGAGCTTGGCCCCCAAACGATTCGTGGTATCAAGCAAGTCATTCGCATTTTGC
CATTCAATGCCTTCAACATGTTTTGGTGGGTCTGTCAGAACCAACGCGGGAACAACCAGACAATAATTCAGCAGACAGATGTGAGGCTCGGCAGTTCACC
TGACGCCAGTCAAATTCCGGGGCCAACAGTTCAAATATTCAATCCGTTTTCGGGCCTATTTTTCGTGCCGCTCCTCGACAAGGTTATCTATCCATTGTAT
GAGAAGTACGCTGGCAAGCCCCCGAGCAGATACggcaaggtgctggctgGTTACATCGTGGCGATCATTGCTATGCTCTGGACAGGATTCTTTGAGATCA
TCCGCCGCAACTCCCCGCGGCTGACGTACGTGGACACCAATGGAGAAACGCAGTACATCTTGAATGACGACGGCGGCCAGCCGATGAACGATATCCCGTG
GTATGCAGCGATTCCGCAGTACTGCCTGGTGTCGTTAGCGACGGTGTTTATCCAGATCTCGACGTACAACATCGGCTACACGGAGGTACCGCTGAGCTTG
TGCGGCATGTCCATCGCTCTGGGATTTTTCATGAACTCCATGGGCAGCACGCTACTATCCGTGTTCGTTCTGCTTTTCGGCAAGTATATCCCCACCGACT
TGAACGACGGTCAcatggagtacatgtactttgcactcgctgctgtgATGGCGATCAATACCTTCTTTTACGTGCTGATAATGAAAGAGATGAACTTCGC
GGTGTTTCCTCCAGTCGAAAAGGA