Description :
From Genome Similarity Track
Location :
Scaffold_105:109237- 112514
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19195hypothetical protein
Phypa_INRA-310PPTG_19196hypothetical protein

Sequence
3277 bases(100 bases per row)
GTCATTCTTGTTTTTTTTTCTCGTAATGGACAAGTCACTTTACATCCTACTGGTCCAACTATGACTCGCCGCCCTGGGTATCTTCATGTTTATATACTGC
GTGTATGTGCGATGTGCAGCCACTTCTGCTCTCTATGCGTTGTGTAGTTGCTTGCGTCGAGGTTAACATTTATGTTCCTTAAAAAAGGAGGTTAAGCTTT
GTATTCGGCGTAGCACTCATAATACATGTTCAGTTTCTACCGAGTTTAACTTTGCTGTTCCATTTGGAGGTTAATCTTAGTGTTCAATACTACCAATGCA
TTTATCCCGCTAGCGATTATTAAGCTTGTAATACACCCCGTTTTGCTCCATATCTTCATCTTTTATGCCTTTGTGTCGTTAAGTGTGTTGTCCTCCACAG
CCTCGGCCTCAAAGAAGCGCTTGCGAACGAGAACACGGCGCTCCTTTTCGAAGGCAGCAACAACGGCCTTGTGAAGGTGCTCTCGCTGCTCCCACGTTGG
TCCCCAGTCCACGAGGTAGTTCGTCTACCTCTTCTCGCGCACGCGGTGTTGCTTCTCACGGTCGACGGGTTCATCATCGTCAACAGATGGAGGAGGCTCG
ACAAGCCATTCTCGGACATCATCAAGACCCGCTCGCCTCTTCTTCCGCTCCTTCATGGATTCGAAGACGACTTAGATAGGTTCTGGTAGCAAACGTGTCG
AGGCAACGACCGTGTTCGAGGTAAGTTGAAGGTAACGAATAGCTTCATCGTCCCGGCGTACCTAGTACGCCTTGACTATTGTGATGCACAGGGTCTTGAA
CTATTTCCAAGAGCTTTCAGGGTTATTGGCCGGCTTGGACATCGGCATGGCAGTGTGATGGTAGAGTGTAAATTGCAGAGTGAGGTCGGGGTTGGGCAAA
CAATTAAAAACGACTGGACTAGGCAAGTATTGTGTTATTACTGGATGTAAACCAAATCTGTTATGCTAGTCGTGTGTAACGGTGCAGGGTCGATGATACG
TCCTGCGGCGTGGAGTTGCTGGTAGCTACGGATATGATCGTTGAGAAAGCCACCCTTGTGGAGCTTGTGCATGAACTTCAAGACGTTTCAGGCTCAACGA
GCGGTAATCTGGTGACCTTGAAGAATGGCCAGCAGCTTCACTTCAGCTTGCGTCCCGATAGCCAGCACTTTATCGCGATATGTCGGCGACTTCTCATTCA
GCGTGAATCCTTCGGGGACGAACAGCTTCATGAAAGCCACGAACAGCTTCATGAAAGCCACGATCATTTTGAAGTTGGACCTCGTGTTATTCGTCTCCGC
GTCTGTTGAGCGCCACATTCGAGGTTCTTGAGCGTACCAAAAGTACCAAGCGTCTTTCAAGCTAGTGGCTGCAGAGGTACGTAATCGCTTCATTGTTTCC
GTCTTATTGACCACATCCTCACTTGGCTTGTCTGCTGATTGTGCTCGCTCGCGCTTGTGGTAGACCTTAGATTCCATGGTAGACAAACGAGCCTCTAGCT
TTTGGTTGATTTGTATTAACTGCTCAATCAACGCCGCTTGGTGACGAAAGACTGGGTGCTCCGTGATATCTTCAGAAGAAGTTGGAGGGATTGGAATGTT
ACCTTTTTCTTCTCAGTTTGCGCAGCAGGACATGTGAGACGACCACGCAAGAAGCTCGCTCGCGGTAACACCTTTCTTCACTGCACATGCCTCGATACAC
TGAACCGCTGGTCCATTCGGCTTTACTCCCTTCAATGAGGGATAGTGGTGCAACAAATATGCCATGAGGGTGTCAAGAATGCGTGAGTTAATGTTCTAAG
CTTCCACGCCGAACCCAGTCGAAGCCCCAAATAGCGCAGAGGCTACATCGCGAATCTTCGTTTTCGTTTCGGAGTCGAAGGTATCCAGAGATAGCAGTGC
TACAGATTTTTCGGTGTCGTGACCACTCAGTACCCGGGCAACCTTGTGATCCTCGGCTGGAGTGTTGATGACGTACACGAACGCTTTGTTGATCGATGTC
CTATTCGACGCGCCTCTGTCAAAGATTCACTATACGCACATACCAGCTCCATCTGCGTGCTGTGCTCCCCCATGGGGAAAGGAATGCGACGTCAAGATCT
CACTTACACCTGCCTTAGCCAACACACGCTCGAGAACGCGATTCACATAACTGTGAATACCGGACGAGACATCGGTGGCCTTCGCCGGATCACCACACTT
TGGCGCTGCTTGAGGATGATCAATCAAGTCGATCAGAGGCGTAGCCGGCGTCAGAGATTCTTGGGATGGCCCATGTTGCTCAGGAAATGGTTGACAAGGG
CCGCCGTTGGAGATGAGTGCGTGACCAGGGTAAGCGCAATGGCGAGTAACGAACAAACGGCAAAGTCGGAGTCTGGGAACAGCGACTTGCTCTTCAGAAA
TCTTGACGCGGATGAACCTAGCGAAGAAGATATCCCCGAACTTGATCGTCAGATTTGTTTTACAGAAAAGCGTCAGATCCGATGCGCGTTCGAAGAGGTA
CCAGAGTAAGCACAAGAGCGCTGCTTCTTGGTAGTCGCTGGGGGTAGTGGCTGTTGAATACAAGTACTCTGTCATCTGTTTAAGCGCTTTCTTCGTACAT
GTTAGGGCCTTGTAAACAAACGTTCCTTACTCGCGTTTCATGCAGTAGCGCTCTAAAATTTGGCCCTTCTTGAGCAGATTCTTTTCAACTTCAGCTCGAC
GCTGGGGGGAATTGGTCGAACAGCCAGGTCTTGACCTGTCGGTAGTATTATATTACAAAATGTCGAGCGAGAAGCAGGCCCTTACGGCCCTCCTTGAAGG
CGAGGTACATGCCAAACTTATCCATCACAGCTTCCAGAACCAGCGCGTTTGTGTTGCGTCTCATAGACGTCTCCAAGTATTCACAGGCACCATTTTTGTC
CTTTAGTAACGTTAGAAACGAGCGTGCCGCGCTATCTCGGGCGCGCTTCGTGTTGATAGGTGCAGGTCGTCCAGACTCATGGTGAGTCGGAGATGTCGGA
GATTTTGTGTTATTTAAGAAATATGCGAATGACTATCAGTTTGTAAAGAAATACCATTAACTGGACGGCCCCCTCCGACTTGACATGTCGGAGGATTGTC
GGAGATGTGGTTGTACACCTACGACGCAGACAGCATCATTTTGATTGAACAAAACTCTGCAGATAATGTGTTTTTATTCGGTAAAAATAATATAACTCTC
ACTGGATTCGATTCATTGGCTAATAACATTAATAATGAATTCAAGAATGGTCGGAGATTTGACTGTATTCATCCATA