Description :
From Genome Similarity Track
Location :
Scaffold_20:109233- 114345
Transcript NameFunction/comments
Phyke_g1276hypothetical protein PHYSODRAFT_313225
Phyke_g1277myosin-like protein

Sequence
5112 bases(100 bases per row)
GTTACAAAGTTGGTCCACTTCAGTTGGTTCGTCCACACGTCGTGTtcatacaaacttcaagtcATTTGTTGCCGCTCCGCTATCTTCACATATCAGTCGC
CGAGTCACTTTTCCTTCTGCTTTCCCACGACGAAGTCTAGGTCCCGTTCAGGCTCATGGCGTCCTCCGAGGAGCTTCGCGCAGAGAACGAGCGCATGCTG
CGCGACATCCACACACTGCTGAGCGCCAACACAACGCTGCAGAAGGAAATGCTCAAGATTGACTCGGAGCGCGACGAACTAGAGGCCACAGGCCAGAAGA
AGGTGCAGACGCTGGCAGAGGAACTCGAGACagtggacgaggagctcgaAACGCTGCGTTCGCAATGCCAGTCCATGTCGGAGGTGCTCAGCAACTCGCA
GGAGaacgaggtggaggaggagccGGAGCCGGAGCCAACGCCATTTCCTCGCAAATTGTCCACAGCGTTCAatcaaacgctgcagcgcGCTCGCGGTATG
TCGATGCCCCGCAAGAGACGCACGTCGACTGTGGAGAAAATGACCCACGGAGTCCGTGACGGACTGACTAAGGCTGCATCTTACATGGTACCGCCACGAC
ACAGTCCGGAGGAGGCTCTACGTACACCTACGATGCACAAGAACAGCCCACCGATCCTATCGTACGGTAAAGGTTCGAGAGACCCCAGCAAGAGTCTGCT
CATCTCGACTCACTCGCACTACGGCAACTTCCGACGACACAGCGGACCGTATCGCAAGAACGTCGAGACCGTCGTGCTGTAAAGCAGCGTCGACTTTCAT
TTTATTTAAACCCAACCCAACACGTCACAGCTAGCAGATAGCTATTCGTCCAATCCAGCGTCGCGTCATATCCTGGAGGACCACATCACTCACCACCCGA
ACTCCATTGCTTTTTCGTCGGCAAAAAAGCAAGCAAGTCTTTCGAGGTGGTATTATACCATCCTTCCTTCGTATTCAGTTCAATATCAAATCCGTCTTGC
CATGTGAAAGGCAACCATGTAAAAACTATGAACCATGTTCATTGCAGATGCTTACGGCATAGACTCTCCCATCAGTTCGCAGGCTTATCCTTAGGATAGG
TCCATGATCAGTGTGTGCATTTGATATCTGTATTGTCTTtatgatgaagctgttggtCTCAACATGCCAAGGATTCATATCAGGCTTCCTCAGCATGCTG
GACAACGCACTACGACTGGGAGATAGAACACACATACAAACCCAAGCGCCAAGAGCACACCGCGCTGCACTAGCTGCTGGCTGGTGTCGTCGACTTGGAG
TCTCTTCGTCTACTTACTGCGCGTTGGCCGACTTCTGACGTGCCAACTTCTGCGCCTTCAGCGAGGCCAGCGTTGGGCGCTCGAACTGAGACTTACCGAG
CTTGCGGTTCACGTAGTACACGCGACCGGTGGAGCGAGACACCTTGGCCTCCCAACCGACTGGCAGCGACACCTCCGGAAGTGCATCCAGGTTGAATGAT
TCACGAACAGGGCGGTCCTCCACTGGTTTCACCTTTGCAATCTTTGAGGTCACAACAGTAGTCGAGGCGACGTTATCCGCAGCTGCAAACTCCTCTGGCT
TACTGTTGGTACGCTTGTTCCGGGAAGCAGCCGTCTTGGCATCATACATACCCTTCACGACGGACATCCGGCCCTTCAGGGTGGACATGGCACCTGACAC
ACCCACCTCCATGCTTTTCACGATTGTGTTGCGCGTTGAGCCGTTCGTGGGGCTGTCCTCACCGTCTACCTCCGACACGTCGAAGCCATCACCATTGTCG
CCCTTAGTCTTAGTCGAGCTCCAGAAGCGGGAGCCCACGCTCATGCTCGGCATGCGCGGGAAGTGGCGCTCCGACGGGCGTGTCTCCGACGAACGGCGGT
TCAGGTCGTCCGAGCCGGTGAGCGAATCCATGAGCACAGTCTCGCGtggcttcttctccttcttaGATCCCAGCGTGCGGAAGATTGATTTCTTCGGCGT
AGTTTTCTTCTCAGGAATACCATCCACGTGAAGTTTGTTCAGTTGCTCTGTCAACTTCTTGTTCTCGGCCTCGAGCTGGCTAATCTTCTTATCCTTATCG
CGTACCGTGTCCTGAAGCTGGCGGACCTTGACATGGTTACCAGCCGACGAGAATTCCTTGTCGCTCTTGAACTTCTCGATTTCTTTCTTCAATCCCTTCA
TCGTaatcttcatctcctcatTCTTGTCACggatcttcttgttctcTTCCGTGAGAGTCTCGATCATGCCGCCAGCATCGGCCATAACCACGCTCGAGGC
AGCGGTTGCATCCGAAGTCGcaacgctgctgcggcgctgcagctgcgcattgcgctcctgctcctcctgcaaAGCTGCCTTCAACTTATGCAACTGGTAA
GCCATGTCAGCATCACGACGCTTCTCCTCAAGAGCAGCCAAGTACTTCGGACGCTGGATCGTCATGCGAACCACAGCCTGTACACGAATAACCATCGCTC
GCATCTTGACGTAGCGGTGACGCTTAACAAAACCACGCACGTAACGTTGGATGATGACAGCGTTGTGGTTGCTCTTCACGTCGACAGCCAACTTACGCCC
CTGAATACCTCGCCACTGGGCTTGCGCCAAAACGAGACCTTTGTGGAATGTGTTGTATCTCCGCATGGCAATCACGCACCGAATCACGGATTGCAACTTG
ATgatcgcctccagctgccgCAAGTATCTGATACGCTGAGTGAAGCCCACCATGATGTTCTGCAGGTACGAGGCCTTGGCGTCGAGGAACTTCTTACGGC
GGTCCTCTAGCTCCTCGAGTACTCCCAACTGAAAGTACACACGAGTCTTACCCATTTGATATTGGGTAGGCGTctcaagcttcagcttgtcCATGAGAAG
CTGACACTTGTCCGCCGCCGTCTCACCTCCACTTGGCACAAACAGCCAGAACTTGTCCAAAATATCTGTGTGCTGTAGGCGGTTTGGATAAGCCGCACGT
GAAATACGAATGGCCTCAATTACACCAGCGCAACGTAGTTGGGACACCACCATTTCCTGGTCCATGGCTGTCGAGCTCTTGATCGGGTTGGGTTTGATGC
AACGCACGTAGTGCACCTTGGTTgcgttgatggtggccatcAGCTCTGTTAAGCTCTCCTTAAACTGTGTTCCAACAGTTCTGATGGACAAAGCGCCACC
GCGCTTTCGGCGACCACCCGACGCCTCCGATGCAGCTGCCTTAGGCTCCGGCTTCGGTTCAAAGAGCTTAGCGATGAATGGTGTAGACGAGCTACGCATG
AGCTCCGACAGGTCGGGCAGCAATGAGTCCTTGTGCTTCTCCAGGAAACCAACCGAATCGTACATGACAGGTGCAGCGTAGTGTTTAATAAGGAATTCCG
TGCGAGACGTACGGGGAAATTCAATGACGTGAGCCATGTCATCCTTGTGTAGTGAAGTCACCTTCGACATGAACGATTCTTCATTGCCTTTTGGCCGCAT
CACCTCTTCATTAAGCAGTGAGATGATACCCATGCGTGACTCAATCACGCTCAACACATCCTGGTTATCTGCGTACTCGATGTGGTCCCATAcgatgcct
tcttcttcatatTCGATCTGCACCGTCTTGAACACATCCTGTGTGAACTTCTGCTGAAGTTTCTCATTGGCGTAGTTGATACAGAATTGCTCGAACGAGT
TGTGTTTGAAGTGCTCGAAACCGAAGATATCCAACACACCCACGTGATTCGCCATGTTGGCATCATCAGCAAGCGACTGGTTAATCGCAGTCACAAGCCA
GTCGAATACGTTTGAATAGATAGCCTTGGCGAGTGCGTCACGACAGTCCATGGCCAACTCCTTTTTCAGTGGCACACTGTACACATCGTTGACAGCACGC
ATGGTACGAGAACACAGCGcagtctgcagcgcctccCAAGTTACACCAAGCATTTGGGTTGCAGCTTGTGCACCATTGTCACCCTCGGTAATGAGCGACT
TCTCATCATCCGACGGGTCTGACATCAGGAGGACTTCACCGAGGTGCAACACACCTGCAAGAACCTCAAACAGCGGCTTCTGGTCATCGTGCGAGAGGCC
AACCAATGTCAGTGCCTCACGGGTTTTGTTGAAGTGGGTGGCATCAGACATTCCCTCGATCTTCTGCACCGTATTGTCACCCGTGTACACATAGTGCTTG
GACGGATCTAGTAGTAGCTCTGGAGCAATATCAGGGGACTCCAGCAATTGATAGAAGATGTGGTAGTTGCGTTCAGGGGATTCGTGTTGGATGACACGTG
TCTTCTCAAGAAGATATGTGCGGCACTTGGCGCCAACAAGCGTGCCGTTTTTGTCGAACTGGAGCTGAGTAAACTTACCGAAACGACTGGAGTTGTCGTT
ACGCACAGTCTTGGCATTACCGAAGGACTCCAGCAGGGGGTTTACCTCAATAATTTTCTTGATGGTAGAGTTGTTCagaccaccagcaatggtAGCCAAG
TGATTCATGAGGATCTTGGTGGTCTCTGTCTTACCAGCACCAGACTCACCACTCACCAGAATGGACTGGTTGCATTCAGAGCGTCTCATATTGTCGTAAG
CCGCCACTGACGTGGCGTACACGTGCGGGGGGAGCTCCTCCTTGGGCTGGTTGAGGTACCGGAGGTGTTGTTCCTCAGCATAGAGGTCTGGGAGCCACTG
GTACGGGTTCACGGCGATACAGATGTCACCTGTGTACGTGTATGGCAGACTCTGCTGGAAACGCTTCTTGACATTGTAGAGAATTGCAGCCTCATGCAGG
TAGTTGAGCATGATCATGTCTTCAATGCCCTCAGACCCCAAGTTTTCGTTCTGGTAGGGCAGAGACTCAAGCTGGTGCACATCCAACAGcgccttggtct
tcttggatAGCATGTCAATGCATCGCTCCTCCGTCTCCCCATCGGGGAGCTCCACGGTGCAGTAGATCTTGCGGGTCTTGCCGTCGCCAGAGTTCTCGTC
ACGCAGCACTTCGGCTGCGAGCCACACGTGTGTTTCGTCGGGCACGAAGCACTTGGCCCCCACCACCATCTGCAGGTCGCTCATGGTGTCCACTTGTTCT
TGCTTACAAATC