Description :
From Genome Similarity Track
Location :
Scaffold_9:1092249- 1096378
Sequence
4129 bases(100 bases per row)
ACTTTGGTGTAGACACACCAAAGGCTACATACATTAACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGTTGAGAGCAGCATCTTT
TAGCCAATGAGTGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGTTCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAAATAACTCTAATTTA
AACTAGGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACGGAGGTGTCCAGGGAAAGCTCCACTACCCCTGCA
ACTCAAGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTCATTGGAGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACAGTGTTGCTCTGGGATTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGTCGTCCGG
GACGACACCACGCTCAATCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGGTTGTCGAACTAGACACTGCCAT
TGCGGCTCGACGTATCATCGACCCGTTGTCGAAGGTTGCGTACGCCATGTCATGCCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCG
GGTCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACAAGCATTTGAGCCCCCGCAAAATGAGTTCCGGTCGAGGGCGGAGTTCCTCG
ACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATTGTGACCAATCCGATCGACGAGGCGACCAAGGT
CGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGATCTATCTCTTTCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAG
GAGGAGTTTAGCCTGCGGCAGGCTAAGCAGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCT
CGAGTGCTGCAACTGCTGGATCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGTGGTAGAGTCGGTCTCTTTGCTCGGGAGTGCACGTCCGT
GCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACACTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTATCGCAG
TTCCGCGTATCGACCTTTGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGACTCATTATCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCAT
CCTGAATGTGGACTCGATGAGAGCAAGTGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTT
GACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTAGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCA
CGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGGTCTGGACGATGAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCC
GGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGTG
CGCGACTCCCCACTCGAGACAGCGCCTAATGCCACTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGTGTTGCCGC
CAACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAAAGTCTCCGGCTTCAAGGGGCACGGATGACGCAGG
CGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATTTGATTGGATCAGTTTTGGCCAATCATAAGAGCCAAGGTGACGAAACGCCGTCGACTCCGGGA
GTCGACGGCTTGCGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTATTGGGGGTCTCCGCCAACGGTTGGCGTCGAGGTATTGAAGTCG
CATCGACTCCAGGAGTCGATAGCTTGGACGAATTTGATTCGTCGGCTCGGGGAGCCGATGCACCCTCCGAACTGAGGCAGTTCTTCATGGAGACCACCAC
TGAGAGCGAGGACACTCTCAGTGCGAAAACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGG
GAGTGTGCGGACGTACTACCGGAAGAGATTACTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAAATTGATCTCGTGCCGGGGACGAAGTACTGTG
TCACGCGGCAGTGGCTACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCATCGCAAAGCTGACAAGTGCGGGAATCGAAATCCCCG
CACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGTGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACAC
CGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGAAGGGTTCTATCAGATCCTCATGCGAGA
GAGCGATATCCCTCTCACGGCTGTGAGCACGCCCAGCGGCATGCTCTGGGAGTGGCTAGTGATACCGCAGGGTCTGAAGAGCGCCCCTGCGACCTTCAAC
AGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATG
TTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCACGCCCAAGCACAAGCTCTATGCGAACCTGAAGAAGTACATCTTCGGGGCGAGCGAGAC
ACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAA
CTGCGGCAGTTCCTTGGCTTGGTCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTGACAGCTCCCGAAGAAGGACGCCG
AGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATT
CCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAG
CTGAAGCCAGCTGAGCGCAACTACCCAGTACATGACAAGGACCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTTGGAAGCAAAC
CATTCGTGGTCTATACGGACCACGTGTCACTGCGGACGGCTGTGAAGTCGCCGCAAATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTA
TAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACACCACGACTGATGCCGACGTCAATGCC
ATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACG
GCTCAGCGCCTTATGGCCAAGCTCGTCAG