Description :
From Genome Similarity Track
Location :
Scaffold_135:10922- 20350
Transcript NameFunction/comments
Phypl_g3928hypothetical protein PHYSODRAFT_314592

Sequence
9428 bases(100 bases per row)
TGCAACGTTGTTTTTTACATAACGTCGGCTTCGGCCTTCCTGGAGTTGATTGACTCTTGCTGTGCGTGTTAGTTGTCCAGGTTGAGCAAGAAGGCAGCGC
CCATCATGACCCAGTAGTTGGGCGGCTTGTCGCTtgggagctggacggcgatgacgaagtTGGTGGAGATGCCCGTGGTGGACAGCGTGCCCTGCCGCAC
CGACGTCTTGTAGACTGGACACGGGTACATCGAGATGCCGGCGCTGAGTGttgcgttgctggtggctgtCGAGGTGGCAGCTGGCAGGAAGTGCACgatg
gacatggaggagaacATCTCGCCGggcttggcgtcctcgaggAGACGGCGCGATGGCGACCACTTCCCGCCTTGCAACCACAGCCCGTCCACGTAGATGC
CGTCGGTCGGGctctgcgtgagctgctgcgcgctctCGACGTCCATCACGGTGAAAGTGAAGGCCAGCGAGTCGATGGCGGTCTGGTATTTACGGGCGAA
GTTCTGCAGCGTGCCGGTCATGAAGCCTTgcgggaagaagaagacgttgaGCTGGAACACGACGGGctcgccgtgcagcagccaTTGGCGGAAGAACGCG
ACGCGGTCGAGCAAGTCCCGCACCCACGAGGCAAGAGGCTTGAGAGACGCAAAGCTAACGGCAGACCAGAGCTGCGGTACTCGGCCATTCAAGAAGGCCG
TGTACATGTTGTCCAGGTCGGAGGACATGACGATGAGCCCGTTGATGGCCTTCTGGATGTCTCTCAGGGACGTGCGCATGCGACGCAACAGGGTGTTGAA
CTTGATGACCTCCTGACCCAAGaccgtggccagcgagtcCATGACGACTGTGCCAGCCACCTCCCGAGTCTTGAAAGTGGTGGggccagcttcttccacG
TTGAGATCAGCAGGCAAGTGCTCCTGAACGGAGATGGCAAGGTCGAGCACGCGCTGATCGTTGGACTTTCCTCCCCCTCCGCCCCCATCTCGTGGCTCGA
GGCTCAAGATCAGCTGCATCATGTTGGCACTTTCGTTGCGCTCGTACGTGACGTTGGCGTTCTCGTGCATGCCGAAGAGCTCCGGGTTGTCAAACGCTGG
CAGAGCGCCCAGATACGACTGGATACTCGGGTGCGAGAGCTCTGTTGGCACATGGTAAATGCCAGAAGACGAGTACGAGTGGCCTGCGTTGAGCACGTCC
GGCGTGTAGAAGTTGCTGAGGATACTGGTAAGACAGCGTCGGTCCCAGTCGTCCGTCACGCGTCCACCGTAGTTGATCTGGCCCGTGACATACCGGAGCG
CGTCCCACGGAACTAGTGGCTGCTCCTCCAAGAACTTGCGCAGACTCGCAAGCGAAGTCTCCAAGTCCGTGTCGTTGAACTCGTACTTGATGTTCCAGCC
CAGGGCGCCAAACTTGCGTCTTTCTTGGACGATTGCGTGGAAGAAGGTGAGCGCACAAAGTAGCGACTTCCACACCTGGTCCTTCGGCTCCCCAGTGTCG
AAGTTCCCGAGGTAACGGAAGCTCTCGAGCACGTCTTCGGCTAGCAACGTGTTGAAAGACCGGAGGAGGTTGGCGCGGATGCCCTTCGGCGGTTCGTTCG
TGAGCTTGATAccgttctgcagcacggtCACGGGGAAATAGGCTGCCGGGAAGCTCGTGAGGAAGAGACGGAAGGTGGCTTGACACTGCTCGTCCGTCCT
CTGGCCCATGTCTTCCACTAGTTTCTCAAGCTTCGGCATCCAAGATTTCGCGAGATGACAgttttgcagcagcacccaGTCGCCGGAGCCCTGACTGCTC
TCGATCAGCTTCTCCGCGCGTGGACCTTGTCCCTGTCCTAGCGAAATGAGGTGCAGGCGGTCGATGAACGACATTTCCTTGGCGAATCGAAGCAGCATCC
CGGTCGGATCAGCGCCTGCAGACAGCACGAAGATGCACGGAGTCTTGCGGTCGGTGTCGTTGTAGATCTCCTccatcgtcgtggacgcgttCCGCCCGAA
CTCCGCCCCCATTTCGGTGGAGATCATGTTCAGCACGGCTTGAGGCACCTTCTCTTCGGCCAAgcctcgaagcagcagcactttTTGGAAGGCGTTGAGT
GTCGAGCCGTAGTTGCCAGGACAGGAGTTGGCATTCGATAAGAGCCCTGGATCTTGGAGCCAAGCCAGCCAGCGTGGCCAGACGTTGGTTAACGAAGTGC
AGAGACCCTGGAAGGCGAGGACTTGTGTCTTTTGGTCGCTTTCTGCTCCGTCGGGGGCAGCCGTGTAGCCTGTGaccaccgtctccagctccgagatcAA
GTCCCATTGCGCTTCACTGATCTGTGCCGGCTGAGGAtttggctgctgcgtggagCGATCCGTGCCAGGCGGAGCTCCACGGAGGTAGAAGGACCACTCT
CGTGCCGATATTTTGCCGGAATGCAGCAGGATCTTGCAGCAGATGAGCATCGAGAAGAGTACCTTGTGCACCTCGAAGAGTCCACGGCAAATGTTCACGT
AGATGTAGCGTGTCTGGAAGTCGATGAGGTTCGTGAGTCGCCTCTGCAGCGTGTCGGCCTTTGGAGCCTCGTCGAAGCAGATATTGAACAAGCGCTGAAA
GAATGGCAGCGAGTACTGGTACATGGGGTCGATGAGAGCGAGATTGGCCACCACGAAGTAGATGATGGACCCGCGAGTAGCCACGCAGCGATACTCTTCT
CGTGCGCGATTGATCTCGATCTCCGTGCTTTCGGATTCCAGTACACGCTCCTTGATGACACGTGAGGTGACGTTCGATGACTGCAGCGTGTCGATGAGGT
CTTGGTCATCCAGCACGTTCCCGGAGGACTCTGAAAGCTGCTTCAAGATGCGGTCTtcgatctccttgagctgctttTTGTCGTGAGCCATGGTGACGAC
CAGCCGattcttcttctcctcgatATCCGGTCGCTCGTGGCGTACCACATCGCCGAGGAGTTGGTCCTCTAGACCGTCCATCGTGACTGTAAAGTTGATG
ACGGTCACCTTGATGTACACCTCTGGAAGGTAGTGAGGGTTCGGCAGCTTGGTTGTGAGGAACAACTTGAACGCGGGGTCGTAGTCCACATCGGAGTCTC
CAAGACGGATGAGCACACGGCCGCCTTGCTTGTAGATGGCCTTCTGCAAGATCGGCTCCAGTGacggctccagcgtctcgtcgaTAtcctcgatgagcag
cgCTTTGCCATTGCGGATGCAAGTCTCCAACGACCGCAGCAGGTTGGCGTTGGTCATTTTCGAGCTTTCGAGCTTCTGGGCCAAGGTTTTCTTGACCCAT
TTGTTGGCTTGGCCTTGTGGATCGATCATCAGTGGCCATCGCTCGCCTCGCGTGACGAGAATGGCGTTGTCCGTCGAGGTTGAGTCAGTCGGAAGTCCAT
TCAGTTGCCACTCGCGGATTTCCACAGGGCTCCCAAGCGTAGTGGAGAGGCTGTAGCCTGGGGAGCAAGGGATGGCGAGTgcctgcgtctgcgtcaCCCA
CTGGTCCACGATGCGCTGGCGGAATCCCCCAGTGAATGGCCCGTAGTACGAgatgcaagctgcagcaaggaATGTATCACCGATCAACGCCAGGATGGAC
TCGGCCAACGACGCCACACTCTCTTTCCATCGAGCGCCTTCCACCGACAGTCCCGAAATTAGTTTCTCGGCTCGAACCAGGCGCTTCTCCGTCACCGCGG
CGTCGTTGGcgagcttgtccttctcgtcgagTGTGTCTTTGcactgcttctccagcatggccACATTCTCGTTGaccacgcgcagctcctctTGCTTCTG
GCCCAGAATCGCGTTGGCTTCGGCCAGTTTCTGGTTCATGCGCTCGAGATTTTCCTTCTTGGGCCCGACCTCTTTCGCCACTTTGGAGTACACGTCCATG
GCGTGCACCCACATGCAGAGCGACGTCGCGGCCTTGGACACTTTCGagaccacttcaactgccATGCCCGGCTCCGAGACCGCTTTGCTCAGTTTCTTGA
GTGTGGCGGCCGGGATGTTGTCCTTGTCGaagttcttgagcttgtcgaggAACGTGACGTCGCCCAGAACCTTCTTGGCGCCATCCCAGCTTTGCTTCTC
GTTGAAGAGCAGACACACGGCGTTCATGAccgtctccaccgcctcggGCGGCTTGGCGAAGGACTTGACCTCGGTGATATCGTTCTTGGACAGACTATCA
AGCGCCTTGATGGCGTTCTGGAGCGCCGGCATGGCCACGTCGAGATCCTTTTGGGCGTCAGCCTGGACGATCGCGACCTCGTCCGCTTGCTTCGTGACAG
TCGCTTCATCGTGCGAGACGCGCTCTCGCACAACGGCCGCTGCCTTCTGGTCCACCGACACCCGCTTGAGCAATTCCTCGGCTTCGATGGCTTTCTTGGC
CAAAatgggctgcagctcaaTGAGCTCGGACTGCAACGAGTCCACGATGCTGTTggtctcctcgagcttcttgacgccgaCTTCCATGCGGTTCTTggtc
gtctgcagcacggcgcgcttctcctgcagcatcttgaggTACAGTCCGATGAGGTCCAAGTAGCTCTTGGGCGTCGTGTACACGTATCGCTGGAGTTGCG
AGAGGAACTCGTCGCCAAAGTCGTTGGACGTCGTGTGCACGATGGAGCACATGTCCACCAGTGCCGTCCGGACGTCTTCGGAGGGCAAGGACACGCTGGC
GAGCAGTCGATCGGccaccgactgcagcgcttcACGGGGCCAATTCATGTACCAGTCGATGGTGCAGCAGTTGATGAGCGACGGGAACGCTCGACAGCGC
ACGCGAAGCGCCGACCCGACCGGGGACATGGCCAGCACAATGTGGAGATAGTTGCGTACGCGCTCGATGAAGGTGGACGCGCAGTTGTCGCGCGTCTCGG
GGATCTCCATGGCCTTGAGAATGGGGCGCATGTCCGCGATGATGCGGTCCATTTCGTCCTGCGGGAACAAGTTGGGCACTTCTCCACTATTCAAGACGTT
GTTGATGTCCTCCAGGAAACTCTCCTCGACGATCTGGCTGTCcgtgaagaggaagacggTCGACTGGCCGCCCACGCCAGCGCTGatcatgagcttcttg
aggtcTTCGTGGAACTCGTTGGTGCCGTACCCGCGCGTGATCTCGATCTGCACGCACTTGGCGTCCACCATGAACGCGCCAAGCCGCGCGAGCGACTGCT
TGCCACTCCCACCGACGCCGATCAGCATCGCGTTGCCTCGAGGCTGGCGTAAGATTCGCACCAGCCTCGACAAGTGCGCGATCGCGTCtcggaagaagac
gaggttCATTTTATTCGCGAAGGTGACGTTGTAGTTTTCCAGGAAGTCGTCCATGATCTTGGTGACTTTGGACACGTCGTGGCAGTGCTCGTACAGCGGC
GCCGGAACGCCTGGcttgaagaagtcgccgAACGTAAGCGGACACGGCGAGTGGAAGAGCGTCTCGCGCGCCCAATTGCAGTTAAAAAAGCGCTGGAGCA
AGGCGCACACGAGTTCCTCGAACCACGTTTGGTCGGAGGCGCTGATGAGTCGGTCCTGGAACACGCGCGCGGCCTCGTGGACCCACAAGCGGTTCATCGA
GTCTGCGTCGGGGCATTTGCCCGGCGTGATCATGAGAATGCCCTGGAACACCTTGGACACGTCTCGAAGATTGAACGTGTAGTGGAACTTGTtcggcgtc
ggcagcagctcgagcgtcacGCGGTTGTAGATCTCGATGATACTCGAGATCATGCCGTCTTTCATGGCCTTCACGGACGGCGCGAACCTGTCTAAGAAGC
CTCCGAGGATCGAAGCGAAGATGAGCTTCAGAGACGTCTCCCCTGTCGAATACATGCTCAAGACGTGGAAGTGGCGTACAAAGCGCGGCGTGCAGTGCGa
ccggccgccgccagcaggggcggcggccgcgagcagcaTCGTGTCTGCGATGTCTTTCCAGAAGAGTTTGTCGCGGTCGTAGAAGCCGCCGAAGTCGAGG
AACTGGCGCAACAACTCGATGGGCGCTTGTGCGCCGTACTCCTCGACTGCTGGCAGgttcacgtcgtcgacaaaGATGATCATCCGCTTGCCTGCCACTG
GCCCGAGCAagttcttgcgcttcttctcgagcttgttcTCAATGGTCAACTGCGTGACGAGAGACGACGTCTGCGCCGAGaagttgatgaagatggtCAT
GAAGTTGGACGCTGGGGCGGACGGGgcgtctccaccaccttctccattGGCGTCGCCGCTTGGTACCATGGGTCCGGCCGTCAATTCCTGCAACAGATCC
TGAACAATTACGGTTTTACCCGTCCCGGTGATGCCGGTCACGTACGCTGGTCTCTTCGCTGCGGTCAAGGtgcgcagcaggaacgtAAACCTCACGGAGT
CAGGtgtcgccaccgtcatctTGAAGTAAGGCACTTGCGCATTGTACTGGAACTTGGGGACCACTTCGCTCCAAGCGCGGAATTTGGcctgctcgacgtc
gacgaagTAGTCGAACACCAGTCCGGCGTTCGGGAGGTTCAGCTTCGCGTCGCCCATCAACTCGCGTGCGAAGCTGTCGAACTGTTCGTGGGTGTCCACT
GTCATCGTCGCGCCGACAGAccagaagagcgagaaggcgaACACTTTgtccagaagctcgagcatTTCCTCCGTTTTCATGCGCGAGTAGTCCACGCCGC
CGGTAGGACTGAACAAACACGCAAAGAGCCGACACAAGCTCGTGGCGAGGTTCATGTCCACCGTTgggacgagctcgaagctctTCTTGCGTACGAAGTG
GATGCATTTCTCCACGTAACTCGTGATGAGGAACTCGAGGCGTGTGAGGCCGTCAGGTGGGAAGTCCGACGGCAGTTCCTTGTCCATCCACGTTTGCACG
AACGGCATCCAGCCTAGATCGGTTGCGGTCATGTACACAACGCCGATGCGACTCACCGTCGCGGGGGAAGCCACGGCCAGATCCATGACCTCGAACAGCA
TTTTCATCTCATTCTTGAGCTTGATCCGCTCCCCGTTCGCGAGACACAGCGTCATGTTGTCGTCCAAGACCGTGTTCATGTTTTCAATCCACAGCGCGTC
GATGGGTCCGTCGAACACCGTCCACTTGACGTCCGAGGATTCATCCGCCACAGCTTCGCGCATGATCGTGGAGGCCAAGCCGTCGTGCCATTCCTGAGTG
GCTTCGTTGAACTCCCCGTACAGCTCGCCCATGGAAATGCACTTGGGGTTGAGTACCCTCGCGTACACCGTTTGGTACACGGGGTTCTTGGAGCCCTTGG
CTCGCAGCGAGGTCATGGTGGACTGCAGCGTTCGATAGCAAGACGTTTTCCCAGCACCGGTGGGACCAACAAGCGTCCCACCAAAGCGAACGTTGAAGAT
ATCGAAGAGCTGGATGACCTTGGTGATGTACGTAGGCACCTTTTGTAGCCCCGCCTTGGTGATCTCTTCCTCGAGAGACGCCTGGAGCTCCCCGTAGTCG
TTTGGCGGGATGTCCGTGCCTGGGAACAAGTCGAGCACTATGGCGTGGAACAGTGGGAGGTCGTCGGCCAAGAATTTCGGGATGTTGCTGTCCCGTAGTG
CTCGAATGAGCGTCACGTCCTCGTTCAAGTCGGGGTTGGCGCGCTTGAGCGAGCCAGCCATGACCAGCACCGACTTGACAGCACGAAGACCGTAGTCGTA
GTGTGGCTGTTGCGAGAGCTGCTCACTGCAGAGGATGTAGAGCTTGCACATCTTTCGCGACAGCGTGCGGGCATCGCCGAACCCCTCAGCGAACAGCATG
ATTTCGGCGATCAGCGCGTAGTCGGGCACCATCATGGACACAGGTCGGAAGCACACCTTGAGATTATCGGGAAGTTCCGTGCGACCGGCGTAACCAGGAT
TCATGGTCACGATGACGTGGTGGTCTTTGAGGAGGATCTCAATGCCCATGAAGTTGATGTGCTCCTTGCCCTGAATACGCCCTTCGCGCAGGAtcagaag
ctgctgggccaccACGGACAGCACTTCGATGTCAATGCGGTTGAATTCGTCCAGGCACGTCCAGTTTCCGGCCTGTGCGAGGCCACGGAAGAGCTTGCCC
ATCATTTTGTAGTCGATCTggtcgctgcagttgaacACAACGCACTGGATGGCCATGGCTTTGGCCAGGTCTTTGCTGCTCTCGGTTTTGCCCGTTCCGG
CCGGACCTGCGGGAGCTGCGCCAAGCTTCATCCCGTACGCTCCGGTGAGTGTCATCCAGCAACGATCCGTTAAGGGCGTGATCACTAGACGCGAGGTGGC
CCCCATGTACTCGTAGCCGTACTGGATGACCGAGTCGGAGTGCCGAATGAGGACGTCGTCTGCCTGGGCGTCCCAGTAGTAGCGCAGTTGTTGCTGCCAG
ATGAAGTTGCCCACGGAGTCCACTTTCTCGGTCCACAGACTCTCCACGATGTCGCGTGCGTGCACATCGGTCGTCACCAACGCCACAATGACCTTGCGCT
CGAGGGAGCTCAGGTCTCCACGAATCTTCACGATCAGTTCATTGAGCTCGTACAGGTTGCGTTTGAACCAGGCGTGCATTTCCTCAACggggttgctgct
gttcagagcttcttcggtGCTGCGCGCCCACGTCATCTGCGCCACCGTGGCCACAACTTGTCCGGGGTGGTCACAGACCCACACGGACCTCTGCTTGGTG
TCGTAGTCGACAAGCCCGGCCTTCATGAGCTTGTAGATCGACTGCTTCATACTCACTTCCAGAGCCTTCAGCCAGTCCTCGACGTTGCCTCGCGCTTTCA
AATTTTTCCCCAGAGGAACGCGCTCGTTCTCGGACGAGTACATGGCGATCATGTCCACGCTGCCGGGGACGTCTCCGAAGTCCAGTTTCACGAGGTTCTC
GAAACACTTGCGCAGGTGTGGCTGCACCGCCTGCGGATTCTTGGACTGCGCCAGAATTTCCAGCAACTCATCGTTGGACAGGAAGTAAAACCGAGGGAAG
GCCATGCGTTTGGTCTCGAGGTAGTCCTCCAGGTTCTTCTGGATCTTGTCCAGGTGCgcgttgtgctgctgcaacgtctCCTTGATGCCAGGGAACGTGC
CGGACGTCAACACGTGCGGGTTCTCGTTGGTGCGGCGCATAATCGTTTTCCAGGATGCGTCCACGTGGCTGAAGATCTTGGACGCATCCGGCAATTGCCG
CTGGATGTCCGGAGCCGAGAAGATATTCTCCAGGTACATCCAGTTCTTCTGTACGAGCAGCCACTCGTCCAGTGTTTCCTGCAGGGtcacgagcttcttc
ctccagcCCTCCACTTCTTCCTGAATGGCACCGATGAAGCGAGAACCCATGATCGTACTGATCGTCACGATCGAAtcgtccagcttggcagTGACCTCCT
CAACGCTGCCCAGAACGAACACGTCTTT