Description :
From Genome Similarity Track
Location :
Scaffold_788:10922- 13621
Sequence
2699 bases(100 bases per row)
CTGACATGTTTACGAACGGGGAGCCCAGACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATT
TCGACAGCTGCCTGGCGACGCTGGACCGATTGCTAGCAAGATTCGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGT
GGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGC
ATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTG
TCGTTGAAGGTGGCCTTTCTGTGGCACGTCATTCCTTCGAAAGATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGA
AGTTCACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGACGGCAAGTTACACCCCGTACATTTCCTCGGTCGGGTG
CTCAAGGAGGCCGAGATGAACTACCATCCAGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGC
TACATGTCTATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCA
CCTTAAGGTGCAGCGCGTGAAAGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAAGACTCGCTCGCGCCG
GTGGCGCCTCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAGTCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTG
ACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTA
CCTCTCGGCTACCACGGTGAATGAGGCAGAGTATACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTACCGAGGATTTAGTCATCGTTGGT
GACTCACGGCTCGCCATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACGTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGC
TTCGATCAGTTAAATACCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTAATCTT
GGCTGAAGCTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACAAGGAGCA
GAGCGTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCCAAGTGGAAAACTCTTCGAAATTTCCGTGGTTGAATACAGCCTCACCAAAGTGCGATTATGT
AATATGTGCCAGTGATGTACTCGGCGACGACGCAAGCCAAGAAAACGCGTCAGGTTGCAGAATTAACACTCCGGAAGGATGTCTCAAAGGCTCCAGAGCA
GAATGAAGAAACGACCAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCAGCGCCGTTTCCCGATGCGGA
AGATGTTGACCCGGTAGCGATACAGCGGGAACGACGCAGACGGATACAGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGTGCTTCAG
GGCCAAGCACAAGAGCTGAGTTACAAAGCAGCTCGAGATGCCTGGAAATACGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGAT
TGAATCGTCGGTACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCGACAACGATGATTCAAGAGGTCTTGCAGAACTGTTACGACTC
GCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGTTAAGTCCGATTATTATTGGATCGGCTTGTACGCTGACGTGGAGAAGCATGTGAAG
TCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCGCAGCTTCGTGGATACTCACCTGGCAACGTACTAGCCGAACGACCTTTCCAGATCGTCTCGATGG
ATTTTGTGATCCCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTTACGGGATTCGTTATTGCCAAGGCTATGTCAGA
TACGACTGCACTGAGTGCTGCCCAAGTGCTCGAAGAATGTGTGTACCGACGATTCGAGACCCCATCATTATATAGGCACGACCGCGACCCACGCTTCATT
AGCGAGGTTTTCCAAGCATTTGCAGAGATGATGCAGTCAAGATCACGAGCGACTTTGAGCTATCGACCACAGGCTAATGGACAGCAGGAACGCTCGGTGA
AGTCAGTGATGGGTTCCGTACGGGTGTACGCGGAAGACCCTATACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTATTTGCGATTAATACTTCTC