Description :
From Genome Similarity Track
Location :
Scaffold_723:10917- 13119
Sequence
2202 bases(100 bases per row)
AGGTCCGTCCGTACGCGAACCCGACCGAGACTTACCAGTACTACAAGCTGCCGTTCTGCAAGCCCAAGGAGCGCCAATGGGATGACCACGACCTCGGTGA
GCTGCTCACGGGCAGCCGCAAGGTCGTGACGGACTACAAGATCTACGTTGGCGTGGACCAGGCTTACGCACAACTGTGCAAGATGCCCATGTCTTCGGAG
ACGATCCAGGCCTTCCGTGACGCTGTGGACGAAGACTATGAGATATCTTTTTTCCACGATTGCTATTGCTGATTGATAGTGTTGCGAACTCTGGATGCAG
TGGGTTCCTTTAACTCCGGTGAACTTTGAAATGTATCTAGACGATCTCCGTCTCCGTGGGCAGGTCGGGTACATCGTACAGGAAAACATCCGTAAGGTCT
CGTATTACCTGTACACGCACCTCCACTTTGACATCGCGTACAACAGTATCGAATCCGGACGCTTCCAGGTAAGAAGACTACGCTTGACAGACCTAGTACG
GTTGCCTTGGACTTACCGATGCCATTCCCCCCGGTGCTCTAGGTCATGGGCNNNNNNNNNNTGGACGCTTCCAGGTAAAACTACGCTTGACAGACCTATT
ACGGTTGTCTTGGACTCACCGATGCCATTCCTCCCGGTGCTCTAGGTCATGGGCGCCAATTTGACGGCCAAGTCGGCAGATCCGGACCTCAACTACTACT
ACAAGCTGCCAAGCCCGACCGCAGTCAGCAAGCCTGACGCTGTGTTCACGTACAGCGTCAAGTGGCACTTGCGTCCGGATCTCACATACGAAGATCGTAC
CAAGGTCGCGCAGGGAAGCGCGCCCGTGGAGGACCTCGAGCTCCACTGGATCGCCGTCATCAACTCGTTCATTCTCGTGATGATGCTCGTGGCGTTCCTC
TCGATTATCATGATCCGCATTCTCAAGCGCGACTTTTCGCGGTACATGGACGTCGAAGCCGGGGACGACTCGCGGCTCGACGACGACTCGGGCTGGAAGC
TCGTTCACGCAGACGTGTTCCGTATGCCGTCGCACTTGAGTCTCTTTGCCGCCGTCAACGGCGCCGGTGCGCAGCTCTTTGTGATGCTCATGACGGTGCT
GATCTCGTCGCTGCTGGGTCTCGTCAAGCCCAACCGCCGTGGCTCTCTTATGACGGCGTTCATCGTGCTGTACGCGCTCACGTCGTTCGTGGGCGGTTAC
CACTCGGCGCGTCTCTACCGTCAGCTCGGCGGCCAGCGCTGGGTGTGGAACACGTTGCTCTCGGTGTTTGTCGTGCCCGGGCCGCTGCTGATTGTCTTCT
CGTTTCTCAACTCGGTCGCGATCTGGAACGACTCGTCGGCGGCGCTGCCGTTTGGCACGATCATGATCGTGCTGGCGATCTTCATGCTCGTGGCATTGCC
GCTGACGATCATTGGCGGCATCGCTGGTCGCAACACGGCGGGTGACTTCAACGCGCCGTGCCGCACCAACAAGATCGCACGACAGATCCCGGCCGTGCCG
GCCTACCGCTCGCCGGTCGTGCTCATGGTCGCAGCCGGCTGCCTGCCGTTCAGTGCCGTGTACATTGAGCTGCACCACATTTTCGCGGCGATCTGGGGCC
ACTCGATCTACAAGCTCTTCGGGATTCTCTTTCTCTCGATCGTCATGCTCATGTTTGTCACGGCGTTCACGACCATTTCGCTCACGTACATCCAGCTCTC
GTCCGAGGACCATCGCTGGTGGTGGCGCTCGTACTTCTCCGGCGGCGTCACGGGCTTTTTCGTCATGGCCTATGCCGTGTGGTACTACAACAAAGCCACC
GCCATGACGGGCTTTTTCCAGGCGGCATTCTACTTTGGCTACACAGGCATGATGGCGTACGCGATCTTCATCATGCTGGGCTTTATCGGCTTTCGCAGCT
CGCTCATCTTCGTGCGCAAGATCTATCGCACGATCAAGGTCGAGTAGATTGCTGTAGACCATTGTTGAAGCCATTCGCAGAGGACGGAGATTTGCTCAAT
TTCAAATACACATCTTCACGTTTTCATTTTATGATCGGTGTGTCAAAATGACGATTGACACAGCGTGACCTTTCAGGTAACGTTCCGTCACACGTCGCAG
ATGCTGAATTCCCAGCTGACTGGGTGGGGGGTTCGGCTGCTGAACCCCCCGCCGCTGAATCAGCGGTTGAATGGGATGTCCAGCGTGGCAGCCTGTCCTG
CG