Description :
From Genome Similarity Track
Location :
Scaffold_19:109164- 111493
Transcript NameFunction/comments
Hyaar_Emoy2803287Equilibrative Nucleoside Transporter (ENT) Family

Sequence
2329 bases(100 bases per row)
GAGCTTTTTTTTGAACGCTGGTCTCGTACTGGGATCGATGGTGGGTCTCATCCTGGAGAAGCTCGTACTTAGATAGATTGGCCAATCAACGCAGCACGCG
TAGCGTGCCACGTCTGTAATATGTGCCTTCGCTTGCAGGACGCCTGCCGTTGAGCTAATGCTTCAGTGCTTAATGTTGCGTTCCCTCGTTGCAGACTTAA
TGTTCATTGTCAAGACAGGCTTGTAACGGGGTGAACCTGTTACATGTAATTAACCCTTGATACTTGTTAATTAGAATATTATCATAAAGGTTGATAATGT
TCGTGAATATTACCATAAGGAGTAATATTCAGAACACTCACCGATTGGATGATAGGGGTCACCATATCAGCCAGCTCTAGCGGTCCAATCAACGATGGAC
GCGCGCAATGAGTGGTGAGCAAGACTTTAGCATACATTTTTGTAGATAAATATAATTAAGTTAGGACTAAAACATAGGTTAATGATTAGGACTTAATTAA
ATTTAATACAGTTTTACTTTTACCAACAACTAGACTGTCTCTAGTTGTTTTACCTTCCTCTGCACGTTTACACAGAGGTAGCGAGGCACCACTGCACTGC
TGTCGGTGATAGTAGCCCCACACTGGTTGTTCAGTGTGTTGCTCCGGTGCCCGGTTACACCTGTAGCACTTTGTAGGCCGTCCAAGGACCACAAAACCCG
TTCAACATGAACATGTTGGACGACGAAGGCGACGATACCTTTCACGGCACCCGTGATTATTTCTCCTATTTAAGTGATCTCGAGTGGAGTGCGTTTGAAC
GAATGAGCTCGACCGTTGGCGAAGAAGCTGTCTGGTCTCTGCTATCCTCAAGGGATAGGGACCAACAGCATTCCGTAATCGCCAAGTCCTTACAACGAGA
ACTTGACGCGTCGCGAGCTGAAGTGACCTTGCTGCATCAGCACGGTCACCATCAGACTGAGCTCCTGAGACAGCAACGGTTTCAGTCTGCTACTGCAGCG
TCGACACGTGAGCGTTGACGCGAGAATCTAAAGTTAGAAGTCTCCAAGTACCGGGAGTCGAGGAAGACTCCCTATTGAGATGGTTCCTCGAAGTGGACGA
TGCCATTAAGGCTCGCCACATCGATGACGAAGAAATGCAAGTTGCGTTTGCCAAATTGAATTTGTCAGGGAGTGCCAGAACTTGGGCCCTAAATCTTCAA
TTACACAATCCAAATACGTTTGGATCGTTGGCGGTTTTTAAGACTCTGCTCAGCCAAACGTTTGAGCCACCAAGAGCTGAGTTCAGAAATCTTTCAGATC
TCCTGAAGATAAAACAAGATAAGCGTGACGTTCACGCTTACGCTCAGCACGTTCGTTACCTTGCAAGTAGTATGGTAGCGAACCCTTTAAGTGAATTCGT
GTTGATCACGATATTCTTAAAGGGCCTCATAGATGGTCCCGTGAGGAATCACCTATTCCGCATCGAATTGAAGTCGCTCGAGGAAGCGATCACAACTGCG
GTTCAAGAGGACTTTCGTGAGACAGGCTTACACTAGCTTGACCCCCTATCGTCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAAGCAATGGACCTCTGC
AGTGTCGAGAGCGAGAGACCTCGCTCTTCAAGCAGTAAGCGATTGCACTTTTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGCTT
CGCGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGTCTGCCAAGAAGGGCAACGGACGCGGGTCCGACGCCGTTGCGAAGTCACAACAGCCTGG
CGGACCGTCAAAAGACGGTCAGGGCCAGTAAGGGCGGAGCGCCCTACTGATCCAGCAACCTCAATAGAATTTGCAAACCTATTGATGAAAGTTTCTCCAG
ACTCACAATCCTTGTGTGTCTCTGCACTTGGTGATGAGGCAACCCTCATCACCTTGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGA
CTCTGAGACATCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGCTCAAGTTCGTTGAGCACATTACTCCTCCTACGGGGATGACGGTGCTCTTCGCAAC
AGGCGCATCAATAGCAGTGATAAAACGTGTAGTAGGATTTCACTACACGTTAGAAGATTTGCAGTACAACGATGATTTTATCGTACTTGATTTGGATGAA
GAATTTGATGTCATACTAGGGTTACCCTGGCTCGGAAGGTATGAGCTAAGGGTCAGCTGGCAGCATCGAACCGTGAGATGCCTGCCACTTGTTCATCAGA
TGGCCACCTGATGAACGCCTTGGAGCGTT