Description :
From Genome Similarity Track
Location :
Scaffold_94:10915- 16893
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_94-snap-gene-0.10Titin isoform N2-B

Sequence
5978 bases(100 bases per row)
GTCGGGTACTTTGGCGACCCGGCGAACCCCGACCCGGAGCGCGTGAACGAGGGCGCGCCGTTCTCGCCTGACACGCCGCGCGTCTACTTTGGCGGCAACC
TCAAGCGTACGCGCTTCTATACTATGTTTACTATGTTGTAATGGGCTGCTGATGGCTACACACTTGTGACTGCAGAGAACTGTCCCGGGATGGTCGGCCC
GATCAACGACGAGGAGTACTACTGCCGCGGCCGCGACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTGCGTGTGTAACCAGGGGTACACGGGCACTGACTGCACGCAGTGCAAGCCATCGTACTTCAACAGC
GGCGGGCTCTGTTATCCAAAGAGTATCTATCGTAGCGCAATCTGTCTACAGCGTGTCACTGTGGAGCTGCTCTTACTAATCTGTTTAAGTATCCTGCTTA
TCTAATAGAGAGCTGTCCGAACGACTGCTCACAAGGCGGCTCATGCGACTACGCGACGGGCAAATGCGCGTGCGTTGCGAGCCGCAAGGGCGCCGACTGC
AGCCAGGTGTTCTGCCAATTCGACCCGCTCTGCACGAGCTGCACGAGCTCCTCCTGTCTCAGCTGCGTCGAGGGCTTCTTCGTCAACCCAGTGACCCAAA
CATGCGGTGCGTGTGCGTCTTATAAACTTACACTCACCCCAACCAACCACTCATTTTTGATGCGCTAGTGTCCTGTAAGAAGTACGATCCTCGATGCCTG
GTCTGTGACGCGCAGTCGTGTCTCGAGTGCGCCGACCTGCTGCTCAACTCTGTGCGGCGCAGTGGGGCGCGAGCACTCGATGCCTCACTTCCCTTTGACG
AACTCACGCGTGAGTTCTCGTTCAAGTTCTCGTACGGGAGTCAGCTTCCGCGCGTGTTTGATGAGGCCGAATCTTTCTTCCTGACGCCACGCACCAGCAC
CGCTTTCCTCAACGAGTCCAGCAAGACGTGCTCCCAGGGTCTGAATGGTGACGCCTCATGGTCCTGCAAGCCATTTGCTGTCAGCCATTGCGTGTGTGGC
CACAACGGCGTCTTCTCATTCGGATCCCCGGTCTACGCGATCGCAGAATCGGCCAAGAGCATCACGCTGACTGTACAGCGCAGCGGTGGGGGCCTGGGCT
CTGCCACTATGAACTACGACGTCCAGTACCTCACCGCGTCCCCTAGCGACGTATCACCCACGGCGTTCTATACGAGTTCGCAGCTGCTCGTCTTTGACGA
AGGCGTCGTGGAGCTCGCGTTCCAGCTCACGATCCACGACGACCATGTCGTGGAGCCAGATGAGACGTTCCGCGTGACGCTCAGGAACCCAGAGCTGGAG
ACGACAGCGAGCCTGGGCAACCAACGCCAGGCGCTCGTGACGATCCTGGACGACGACGTGGCGTTCGCTGACGCTGGCTTATCGTACGTGGTCGATGCGG
ACAACACACTCAAGCAGGGTGGGCGAGCGGGATCCGACCTGATGTTCAAGATCCAGAGCGTCCTGGGCAACGGCGCAGTCAAGACTGTCGGTGCTGGTGG
TGATATCTTTTTGATGGAGTCGTACATGGCAGACATTGAGGACGATCTTGAGGAGTATGCGTCCTATGAAGTGTATCGCTCCAAGCAGCTTGGAAGGATC
GTCGACAATGCCGACAGTACGTACACGTGTACGTGGCAGCGCAAGCACACAGGGAACTTCACTGTCACGATCTATCTGCTATACCCCGGTGGGCTTCGTG
GCGACTACTACGACGACGCGTGGCTTGGAGACAATGGTCAAATACCGCCAGCGATCACGCGCATCGATCGCCAGATCAACTTCTCGTGGGGCAATGGTCC
GCTCTTTCCTGGGACTTGTGACTACGTCTCAGTGCGCTGGAGTGGCAGGATCAAGCCAAAGAACACGGAGGACGTGACTTTTTACGTGACTGCAGATGAC
CAGAGCCGCCTCTGGATTGGCGACTTCCTGCTCATCGACAAGTGGGACGACACGTCCACGCCAGGTGGCCAGGCGAGCGCGACGATCTCTCTAGACAGCT
CGCTGTACTACGCGATCGTGCTCGACTACCGGGAGTTGGCTGGGAACGCCCAGGTGAGTCTCTGCTGGAGCAGTGCGAGTCTCACCAAGGAGGTCATCCC
AGCCGCGAGTCTGTTTTCTGTCCAACACATCAGCGGCAGTCCGTTTCAGAACGTGACGATCGCGCCAGTGAACACTGCGAACGTGTTCACGAGTACGATC
CAAGGCGTGTTGAGCTCCGTCGCTGGTAGACCACACAGCGTAGAGATCTATCCAATGGATTTGTATGGGAACCCGCGACGCGTTCAGAACGACTCGACGG
ATCTCTTTGAAGCCCGGATGACGCTCACAATTGACCAGAGTCTCGGTGGCATTGGCAGCAGACAGAACGACGCACTCATCGTCTGGAAGCCAGTACGCGA
GGCCTTCAGAGTGTCGTTCACACCACTTATTAGTGGGGTCTACGACCTCGACGTCTGGATCAACACTGTAAAGCTCGGTGGGAGTCCGTTCACGATAGTC
GTCAAGCCTGGACTGATGCACGCAACGAGGTCAGTGATATCAGGTGCTGGCCTGCTGGCCAACCGCGTCGCTGGTATCGCGACAACGCTGCTAGTGGAAG
CCCGTGATGCCAACAACAACCGAATATACACGTCCGGATCGTCACTGTCAACACTGTTGTCGATCCGAGCGTTCCACACGACACAGCTCTCGGCAATTGA
AACTGGTGTTGTGGCTGACAATGGCGACGGGACGTATACGCTCACGTACACCCCACGGATTGCGGGGAACTACAATGTTCGGATCCTGTTGAATGACGGT
ATGGACGTGAACAACAGTCCGTACCTGGTCAGCGTCGTACCGAACGTCCCCATTGGTACGACGAGCTCCGCTGCAGGTACTGGGCTCACCTCAGCAGCTA
CAAATGTCCAGGCGTCCTTCCAGGTCACCACGCGCGACCTTCATGGCAACCTTGTTATCCAGGGCGGCGCGAGTTTCCAAATCTCGGTCGAGCATCCGGT
CAAGGGCATCGTCGCTGGCTCGTGTACTGACATGCTGACAGGCGTGTACTCGTGTGTATATACTGCAAAGTATGTCGGCGCATCGAAGTTAAACATCGTC
CTCACACTTAACGGTGTGTCACTGCCCGTTTCCGGGAGTCCGTTCGCTCTGAATGTGGTCGCAGGGCCAGCCCTCGGCTCTTTCAGTCTCGCACAAGGTC
CTGGGCTCGTGTCTACGATTGCAGGTGTGCGTGCGAGCTTCACAGTGCTGGTGAGAGATGCCTTTGACAATGAGAAGCGCAACGCCGGTCAAGAGATTGT
GAACGTCGTGCTCAGAGGCCCAGCGCCCCTTTCAACAACAACTGTCGTCCCTGTGAGTCAAACAGAACTTGCAGTGACATTCACTGGCGACGACAAGTTC
CAGATCAGTTATGCGCTGCAGGTCAAGGGTAAGTATACCATTCAGGTACAGGTGGACGGCGTTGACGTGGTGGCCAGTCCGTTTACGATCTACACGTACC
CAGCGACGGCCTCGCCTGTGACAACCTCGCTGGACTTGATCTCCCCAGCAGCACCCGTCCAGTACCTCGCGGGCGCACTCATCACGACCAAACTGACCAC
GAGAGACGTCTTTGGCAACTTGTTGGAGAGCGGCGGGTACTCTTTCCAACTGGACGACGCGGTCCGCGGCTTTCAGGCGGATCCAATTTCTGATGCAGGC
GACGGGAGCTATTCGCTGGTGCTGCGGCCTACAAAGACCGGCATTTTCCCGTTTGACCCCAAGATTTTGCTCACTGGAGGGCTTAACGGAACGTATTTTG
CCACACCCGACCTCACAGGCGCGTCTGTTCTCAAGCGCCAGGACCCAGCGGTCGATGTGGACTTTGGCGTGACGTCACCAGTGCAGACAGACACGATGGA
GACCTTCAGTGTGAGCTGGGAGGGCTCCCTGCTGCCAGCGTATAGTGAGTTATATACATTCGACGTCGAGGTGCTCGGTGGTGCGAGTCTCTCGGTGAAC
AACATCCGACTGATCGCTGACCTGTGGCCCGAGGCAAGCATCACGCAGTCCAAGCGACAGAGACAAGTGTACCTGGTGGCCAACCAGTTTGTACCCATCG
AGTTCAACTTCAGCAAGCCGAGAGCGATCCCGAACGGGAAAATCCGACTTTTCTGGCAGAGTCTGTCGCAAAAGCGCGAGGTTGTCCCGACAAACCGGTT
GTTCACGTCCTGGCGGATTGTAAACAACGTTCCGCGACTCGAGATCCTGCCCGCGAGTGCTGACCCGCCATCATTCACGGCGGAGTTCGACCCACAGGCT
ATCGTCATCGCCAGCGAGGCGAGTGCGTCCTCGTCGCCGACGATGCGAGCCACTGCAGGGATCCAGTTCAGCTTCCAGGTCATCGCGAGGGACCAATTTG
CCAACCAGAGGCTTGGTGGTGGAGACACGGTTCAAGTGGTCTTCCCACAGCTCGCTGATGCTGTGAACCCGTCTCCGATTAACATTATCGACCTGATGAA
TGCTCTCTACAGTGTCTCATTCTCGCCAATCCAGAGCGGTAAGTTCTCCATGGTGGTCGCGGCCACGAATCCGAGCATTACTGGCTACGGAGCGCTTGAT
CAAGAAGCCCTGGCGCTCTTCCTGCGTCCGTACTACATCCGCCAGAGTCCATTTACGTTCATCGTCGAGCCAAATGTACCGCTCTCGACGACCTCGACGG
TCACGGGGCTTGGATATTTCCAGGCGACGGCGGGGATCGAGGCCTCCTTCGCTATCCAGCTTCGGGATCTGCACTCCAACACAGTATCCAGTGTCTTGAA
GACGGCGACAGAGTTCAGGACCTCTCTGCCTCGCGTCCAGCTGCGTCTCGGTGGCGTCTCGAGTGGCGTTAACACTGTTGAAGCGAGCTTAACCAGGTCT
GAGGACGGGACGTTCAAGGTCGTGTACATTGCGGCCCATACGGGACTTTACCAAGTCATGCTGAGTTGCGACAGTGGAGCTACGTTCACGGCCAAGAGCT
CCACGCTGCGTGTCTTTCCAAATATCGCGTCGGTGCTCACGTCGACGATCACATCCGGCACGGGGCTCGGTCCCCAGATCCATATTGGCCAACTGGTCAC
GTACAGCATCTCACTGCGGGACTTCTACAGCAACTCGATGGAAATCGGTGGCGACGACCTCGTTGTGGTTCTACGAGGACCTGAGACGGTGTACCCGACC
TCGATCACAGATCTCGCAACGGCCAGCTATATCGTGGCCTACCAGGTGAGTCTATCGGGGAGCTACGAGATTCAGACTTGGCTCGCGTCCCACTACCACG
GACTTCTGGGAAGCTACTTCACGACCACGAGGTTCAGCTCTGCGGTCGCAACCATGGCTTCAGTTCAGGCTATTGACGCGAATCTGGACTTTGACTGGCA
CGCGAACGAGACGATGCGCAACTATCCTCGGATTCGGTGGACAGGGTATCTCAAGCCAAAGTATACAGAGATATACACGCTCCATCTGAGAGTGCGGCCG
TTCGGGGCCGTGTACATTGACCAAGTGCCCGTCATTGATGCGCTGAATACCCCACTAGCGACTGGGATCAATGAGCTGACGAGCCAAGTGAACTTGGTAG
GCGGGCGACTGCATGCAATCACTGTGGAATACCGCAGTCCATCGGCACGCGAGGTCTTTGGATTTGTCTCGCTGCTCTGGGAAAGCGATCGGCAGCAGCT
CGAGGTCGTGCCAACCACTGCATTATTTCCAGGCGCCCAGGAGATCCATCCGAGGTACACGGTCGTTGCAGTCTGAGT