Description :
From Genome Similarity Track
Location :
Scaffold_274:10912- 14045
Transcript NameFunction/comments
Hyaar_Emoy2813429PREDICTED: COMM domain-containing protein 3-like

Sequence
3133 bases(100 bases per row)
ACTGCAGCATGAGCCAATTCCTCCAGAGAAGTTGCAGGTAAAGACGAGAGAAGAGTGAGACTTGAACGAGGCACCACCGACGCATCAGAGACCAAGAAAG
AGACGGACGACGTTCCTGATACGTCACTGATAATGGTCATAATTATTGGTTGTCAATCAAAGCAGAAATGCCAAACACATACCCGAAAACTGAGTCAAAG
TTTTATAACCAGTCTATTAAGACATAGCTACATTCACGCCACGCAGGACATGCGGCGTTCGTTCGTTCCGTCGCGGCCAATCGAAGGTGCTACTCTATGG
ACTTGCGGATTTTATCGTAAAGTATAAACCGATAGTCACCAAAATAGCGAGTATGGAAAAATACACGCCGATCAATGCTTTCTTCGGCATACTCCTGTGT
TTCCCTGCAGTTTTCGCAGCGCCTGTAACCGCCTGAGTGGATTTTCGGCTCGACGTCCTGACTACGTTTTGAGCCACCGCGTTTTCCCTGGTCGTAGACC
GCATCCATGTGGGAACGGCTTTTTCGAAGAGATTCTTAAAAGCTCCTCCTCCTCTTTCCTCCTCCACCGCGTTCTCCTCACGAAGGTTGCCAACCTTGGT
GCTCTCGTCGTTAAGGTTCTCGATCGAGTACGAGTCCGCGCTGGTGAAGCTGACGAAACTTCCGACGATAATGGGCACGAACAGGGCAAGGGCGACGCGA
TAATGCATAGTTGACGAGTTTGACTGTTTTACAGGTTTCGGGTCGGAAACAGAATGTTAAATGAGCTGTTGGCGAGGGAGATATTAGGGCTAACAACGGC
ACAACACATGGAGACCGTGCTTTTTTTCTGGTAGAAGCGCTGTGAGCCGGACATTTCGGAACCAGTCTGTTGGCTTGGTCACATTGCGGGATAGTCGCAC
CTGTGTTCAGACTGATCGTGCGGCCGACGACGTCTTTGACTTTCCAGAGTTCAAGAAAACATGTCTATGCTACAACTGTCTGATGTGAGAACCTCTACAA
GCTGCTGGATCAGTTTGGTCCCCGACCGCCCCTACTTGTTATTGCGAACGATTTCAACTGATAGTTGACAAATGCATCTGGTCCCCAGGGTTTAGTTTAG
AAAGGGTATGTTGCTGTCTATTAAACGATGAATATGGCGGTACAAATGACCGTACGTATTGCTACAAACGCACGTCGTCAGTAAAAGCGAGCATCCTCGT
TTATAGTACCGCTAGTGAGACGTAATCGATGCGATCGGATCAACGTATTATGGCAGCGATAGGCACACAACTCGAGTTCCTTGAAGCGCCTGTATGATCA
ATGGAGACTGCCGCAGTTTTAGCGCGTAGTAATTGTCCGGGTGGTTGATTGACCAATTGTATGCACCAGCAACATGTGCGCTCGCTCTCGCGTGTACTAT
CCGCCAAGAACGATTTGCCGGGTCATTAGTAACATTCTAGAAAAAACACTTTGCCGTGGCGCTTAACTGCCTGTGCAAGCATCTGCTACGGCGGCACGGT
TTTCCACTAATTATGAAAGGCCATGAAGGAGTTTGAAGTGTACTGTACTTTGGCACCAGTAAAATATTAGACGGCACCTGAAAGAATAAAGATCCTTTAT
AAAGCGCTCACAGGTGCACAATAATGCCTTTCTTGCACGGGTAACATGCTGTACATGTACTTTTTTTGGTAACCACCTTCACGCAACTGGGGCTACGCCG
CAGAATTGTGAGCTGTTCGCCGTTGCTGACCTCTATCGTATGAAAGCGATATTCCATTTGATAATGAGCTTACATTACACATCGTCAGCGCGCTGTTTTT
GTGTATGCTGGCAATATGAAATTGTCAGTGCAACTGCAATGAGTTATATGGACCGATTTCGATTGACAAATGAAAGCAAGCACATGCACTTTTGAGGTCT
ACTTCTCCCGCGTATTATTGAGCGCTGGCGATATCCGCTGTGTTTGAGTCGTCAACGCTTACCGACAAACGAGTCAAAAGTATCAAAAATGAATTCACAG
GGACGATGTGAGTCCACAAGAGACTAGCTGCATATGTTATAGCACGCACATGTTCACAAAGGGCAAGAAGTTGCTACAAATATAAGGAGGAGGACTCTAC
TGTTTTGCAACATTTAGGTTCGGCTTGCTGGCCAGACTGGGGTTTATGTTTCTTACACCAACCCGTGCATTGCCTTATGTCGACTTTAAACGTCCACGGG
CAGTCACTGACGTCTCTTGACATCGACTAGAAAGTAAAGTACTTATGTCGTAAGATTGGACGCTAAACATTTGTTCAGCTTTTTGCTTTTATAAAAAACT
TTGGTCTACTTCTGGGTACCATAGTATTTCGTAAAGTTTTTTCTTTCGAAACACTACACGCTGTAGCATGCACTTCAGAAAAGTCGTCCGATTGCACCAG
TTCACCTGAATTCGAAGGTTCTTATCCCCGACGGTACGATGTCCACCTTATGATAGAGACAAATCAATCAGTTGAAGTGTCTGCACGTAAGGATGTATCA
AGACTGTTTCTCGTTTAATTTGGGACGAGCGTAATCATGCGTTGAATGGAAACTGCAGCGCCTCGGTGTCAATGACCGTCTGTGCGTCCAGGACGTGGTC
CGAACAGGTTGTCATACATACATTCATGCGTTGAAGGGTGAGTAATCTGTCGCTTTATGGTCGGGAGGAGGCGAACGACTACAGCGTCGATTGCATAGCT
CACTTCCCATTTTCGTGCTGCAGAAATTATAAGCCGAGCAACACTGTATGTAAGTATGAGAGGGAGAGGTCAATCTGATAGCGCTGGATGGCGAAGACTA
ACGTAAGTAAAATACAACGTTATATCGATACTAACATCTTTATCATGTTTGCCACCATCGAGTACAAGAACAACGTACTCAAGCGTGACCGCCAAATTTT
TTGTTGCTGATGTCGTGCGAGGACCATACCGGCGTCGAGAAATCCGAACATTTCGCATAGATATAATCAGCTATTTACCAAAAATGATTAAAAAATCAGC
AGCGCATCTTTAAAGTGGTGCAATGCTATGCGCCAACGAGCAATAGCACGAGAAAATTCGATAATACTTATGCATAATTTGGACCACAGTGTTGATCGAT
GGTTGTACAGGTCGAACCTTAAGATCATGATCA