Description :
From Genome Similarity Track
Location :
Scaffold_53:10911- 17670
Transcript NameFunction/comments
Phyke_g3472glycosyltransferase

Sequence
6759 bases(100 bases per row)
GGAAGCAGCCAGCACGAAAAGGACCAAGTAAGTGACTGAACTGCGATGGCTATGACGCCAGGAGGCAAAATGGACCGCCGCCGCGCCGGATCCAACTACT
TCCAGCTGGACGCAGACCGGAAGAGAAACCAAAGCAACAATCGCAGTCACATGAACAACGACGGCCGCGGGACGTTCGGAGACCGACTGTCCATGATGGA
CGTCCTCCCGCCTACGACCCACGGAGGACACATGAAGGGAGGGGGCATGGAAGGGGACTTTGCGGACGAAGTGTCTATCGATTTCTGCTGCGAAGTGCTC
TTCAACAAGTTCGGCTTCCAGTCCGGCTCGGTGGACAATCAGCGCgagcacgtgctgctgctattggcCAACGCTAAGGCCCGTGCCAAACCGCAGGACC
CTCCTGGACACCACGtaatgttgctgcagaagaaactCATGTCCAACTACACGGAGTGGTGTCAGTTCATCCAAGTGTCCCCCGTGTCCTACTCGGGACA
GCCCCAGGGGGACCTCAAGAACCCTCTCCATATGGACATTATGCTGTTTTTGCTCGTTTGGGGAGAAGCTGGCAATTTGCGACACATGCCTGAGTGTTTG
TGCTATGTGTATCATCAGTCGTTGTGTATGCTCAACAAGGACTTCCTAGGACAAGAGAAACAATCGGAAGGTTGGTACCTACGAATGGTGGTGCGGCCAA
TCTGGAAGGAGTGCAGCAACATGCAGCGCAAAAACAGTCTCGGCAATAATTTGGAGCACGTCAAGGTGCGCAACTacgacgacatcaacgaGTACTTCTG
GAAAAAATACTGTTTGAACATCGACCTCACGCAGATCGGCGAGGTGTTAGCAAAGAAACACACCAAGACGTACTACGAACACCGCAGTATCTTCACTCTT
GTGCTTAACTATTACCGCATCTTCCAGTTCAACATGATGTTCATGATGGCGCTTATGGCTCTTGGCTTCATCTCAGCCATTTCTCCGAGCGGCGGCAAGA
CGTGGTTCGCTCAGTTTGACTCCATTGGAGAAGTGGTGGATCCCTATGAGAAGCAGGATGTCAAGCTGACGTACGTGGGTTTGGTGTTTTCCCTGGCTGC
CATGGGATTCTGCAAGTGCGTACTGGAAGCTTGCCATGGATGGCATTTGCTGATTGCGAGTGAGGCGGCTGAGACGTCGTCGAGATCCTGGAACTATGGT
ATGGCTCTTGCGGTTCGCATGCTTTGGAACGGTGCCTTCTCGGGCATCTTCGGTATGATGCTGTACAAGCCTCTGACAAGTGGCACAAACACAGAGCTGT
TGGACAAGGCTGCGGCTGCTAGTGCTGCGTACGTCCTTCCTGGCGCGTGCATCTTGCTCACCCAAGCTGTTGCACCGTCTGTGATTATGAAGTCATTTGC
AGCCAAGTTCATTCGTGAGGGCGAGTCTTGCTACGTGGGACGGAACATGGCGCCCCCCTTCAGGTTCCAGGTAAAGTACATCATCTTCTGGTTGATTTTG
TGGTCGCTCAAGGCGTTCGTGTCGTACTTCATTCTTGTCCGTCCACTGGTTCTTCCCTCGCTTGCCATTTacgagatggagctggaatACGGAAGTAACG
TGGTCTCATTTCACAACGTCGGAGTGATTTTGGCGTTGTGGTTGCCAGTGgtcttcattttcaactACGACACACAAATTTACTTCACCATGTTCCAGGC
TACTCTTGGTGGTATTCAGGGTCTTATGATGAAGACGGGTGAAATTCACGGTATCAAGGAAATCACAAAGGCATTCCGTGTAGCTCCGCAGCTCTTCGAC
CAGAAAGTTGTGACTAACCTTGCCCGTTCAAATGATGCGGCAGCGGATGGCTCCGCGGCAGCGTACCAGTCGCAGATGATGCTTCGTTTCGTCGTCGTGT
GGAACGAGATCGTGAACTCTTTCCGTGAGGGCGATCTCGTGGATGACAAGGAGGCTGCGATCTTGCAGTACGACATCCAGAGCTCGGGCGATGTATTTGA
GCCTGTGTTCCTTTCGGCTGGTAAGCTTGTGGAAGCACTAGACTACACCGTCAAGCTGGCTAAGGAAGGCAAGGGAGATTCACAGCTTCAGGTGTACATG
GTCCAGAAGGATTGTTTGTCTGCGGTGCGCAGTTTCTTCACAGCTAGTATGTACGTGATGGAAGCCCTATTAGGCAGCGACGATGCAGACATCCTGGACG
CTCTTCGTCAGATGGAAACGATTGCCGCTAACGGCAGTTTTATGGGCACGTTTGACGCCAAAAGCTTGGTGCAGTTGCGCACTGTATCGATGGAGTTCCT
AGAGGCTGTGATGGACCTACCAGATCCCGATGCACAGTCTTCACACCTAACGACATCGAGAGTACACACTATGGGCGTTGTACGCAACTTCGTGACAAAG
ATGGAGAACCTGCTCAACGCTGTCCGCATTTTTGCGAACCGCCCTGAACTCGCTGCGAAGTTCAGCAACTCAAAGTTCTGCTCTAGTGCCAACGGATATG
TTTTTGCTGCCCGTGGACTGGTGAACCTGTTCCACAACGACACAGCGATGGGCGCTGCTACGCGCGCGTACTTGCTCATGTCCCTTGAGAAGGCGGATGC
GATGCCGAGAGTGCCCGAAGCccagcgtcgtcttggtTTCTTCATGAAATCACTTCTTATGGACATCCCGCAGCTGACGTCGGTCAAGGAGATGCACTCT
TTCTCTGTCGTGACACCGTTTTACAGTGAGAGCGTCCTCATCTCTCTGAATGAGCTGAACGATCCACTGGTGAACCACCCAGTGTTCCAGAGGGTCGAAG
AGAAGGGAAAGAACATTACTATTTTGAAATACCTGATCACGATTCACCCGGAAGAGTGGGAAAATTTCTTGGAGCGTATCGATGTAAGTTCACCAGAGGA
AGCGCAGGCAAACTACCCGCTGGAAATCCGATTGTGGGCATCCTACCGTGGTCAAACACTGGCGCGTACCGTGCAGGGTATGATGTTGTACGAAGATGCG
ATTAAGATCCTGCACTGGCTGGAAATTGGCTCAAGCCCTGGCAAGTCTgccgagcagaagcaagCTCAACTGGAAGACATGGTCCGTCTGAAATTCTCGT
ACATTTGCGCTTGTCAGGTGTACGGCAAACATCGTGCTGAGAACAAACCTCAAGCCGATGATATCGATTATCTTTTGAAGACGTACCCGAACCTGCGTGT
GGCTTACGTGGACACGATTGTGAATGATGGCGGAAAGCAGTTTGACACTGTGCTTATTAAGAGTGAAGGCAACGAGATCGCCGAGGTATACCGTTACGAG
CTGCCTGGTGACCCGATTGTTGGTGAAGGTAAACCTGAAAACCAGAACAACGCGCTTCCGTTTACGCGTGGCGAATACTTACAGACAATCGATATGAACC
AGCAGCATTACTTCGAGGAGTGTCTGAAGATGCCCCAGCTTCTTGTGACCGCTGACCAACACCCTTCAAAGAAGCCTGTATCGATCATTGGTATGCGTGA
GCACATTTTCACGGGTAACGCTTCGTCTCTATCGAAGTTCAAGTCGTGGCAAGAGCTGGTTTTCGTGACGCTGTCGCAGCGTGTGCTAGCTGATCCTCTA
TGGACTCGTATGCACTACGGTCACCCTGATATTTTCGACAAGATCATTGCAAttcctcgtggtggtgtATCGAAGGCTAGTAAGGGTATCAACCTGTCAG
AAGATGTGTTCGCTGGTTTCAACTCCACCCTTCGTGGTGGAGTAGTGACGCATGTGGAGTTCATGCAGTGTGGTAAGGGCCGTGATGTGGCGCTTTCGCA
AATTTCCATGTTCGAAGGCAAGCTTGCAAATGGTGCCGGTGAGACGTGTCTAGCTCGTGAAGCCCATCGCATGGGCCAGTTCATGGACTTCTTCCGCTTG
AACTCGATGTACTACTCCCACACGGGCTTTTACTTCGCTACGTGGATGACAATTGTGACAACGttcgtgtacatgtactgtaaGGTGTATCTGgcgcttg
ctggtgttcagcagcagattgtgTACGACATGAACTCCACGTCAGTGATCACGTTAAACATCGAAAACAACTTTGACGGGCGGGTGTTTACAGACCTAAA
GTCTGTGATGAACACGCAGTTCTATATCCAAGCCGGTCTGTTTCTGATGCTGCCGTTGATGTGCGTGTACTTCGGCGAAGGAGGTCTGGTACGCGGTATG
TGGCGTTTCATTGACATGATTATCACACTTGGCCctgccttcttcgtgttcCAAGTGGGCACAACGATGCATTActtcgacaacaacatcGTGCACGGTG
GTGCAAAGTACCAGGCCACTGGTCGTGGTTTCAAGATTTCTCGAGAAACCCTGGTGTTACTATGGAAGGCTTACGCAAGTTCACATTATCGAAAAGCATT
TGAGCTGATTGGCTTGTGTATTGTGTACGGCATCTTCGGCAACTTTTACATTTGCCAGACAGATGCATCAGCCAATGACAATACTTTTGCGTCAGATTAC
TGTGACGTTGCTCAAGCCTACGGTGTGCAAACGTTCTCCGTTTGGTTCATTTCGATCTTGTGGGTCGTCGGTCCGTTCCTATTCAACAGTGACGGTCTTG
ATTTCCAAAAGACCAAGGTTGATATCGCACAATGGTGCTTGTGGATGTTTGCGGACGAGGACTACAAGGACGATGACCCGGTGAACAAGGGCGGTTGGGT
TGGCTGGTGGAGGGGagagctggaacagcttcaCAACTCGAACATGATTTCGCGTGTGACTGTGATTCTTCGCGAGTGCCGACACTTCCTGCTTATGTTC
TACGTGGCTACCCTCGAAACCTCTGACGTGATGTACGTGGGATACTCATTTGGTGCTGCCTGGGCCACCGTTCTCCTTCTCGGTGTGTTCCACGCTATTG
GTCTCGGCATGAAGTCGATTAGTCCGGTCACCCGGGCTGTGATTTACTTGATTACAATGGCTCTCATTGTCACGGCATACTTCTTGGCCACATGGATCGT
GCTAGATTACACCTTTAGCTACGCTATGTCGCTTTTCCTCGCCTACGTTGCTGCTCTATACGGTATCAACGAGTGTTTCCGCATGTGGAGCTTCCCGCAT
TCGTCGATTAAAAGCATCCCTGttttccagcagctacagttCCTGTTtgacttcatcttctgcacgGCCATGATCGTTCCTCTGTTCGTGATGTCGTGCA
TCCCCTTCCTAAACATCATCCAGACGCGTATGATGTACAACGAAGGTTTCTCCAAGGTCATGTCGGCATCTTCGCAGTACGCGTTCTCGCTGGCATGCTT
CATGGGTATTTTAGGTGGCGTTGGCACGGGCTGGTTATTCAACCTGCTGTCCACGTTGGAGCAGTCTGCGAGTTTTGCAAGTTATGTCGTCACTTACGAC
GGTGTTCTAAGTGGCAACGTGGGCGACGGTACGACGACGTTCATGCTGTACGGTGCTTGTATTATTGGCACGGTGATCGCTGGCTTCTTGAACTATTTCC
TGGGCCGTCGTTTGTCGATCGTGGCTGGTGGTCTGTTCTGCACTCTTGGTATGGTGGCTGTCAGCGCCAACGATGATTTACGCTCCACGCTGCTAATGCC
TGGTATTGGACTGCTTGGCGCATCCGTCGGCATTCTACTGCCTTCGCTGGCCATTTACATCTTTGAAATTTCGACCAAGGAGATGCGCGGCAAGGCCATT
CTGCTGCTCGGCATTGGATTCATCGCCGGCAGTCTGCTGGGCGGCGTCTTCGCAACAGTGAAGCAGCTTGGGTGGATCTGGCAAACGTTTGCTGCTTGTA
TCATTATTGCGCTGGTCACGCCAGTGGTCAACGTATTCCCGGAGAGTCCGTACTGGGTGCTGGAGCGCAAGGGCTGGGACGCGTGCGAAGCTTGCCTTGT
GGTTCTGCGCCGTAAGCCTGATGTTCAGGAAGAGCTTAAGATTATGCGCGACGAAGAATCTGCCGATGAGGGTGCCTCTGGCCCGTTTAAATTCCTCATT
GGTGTGTTCCTGATGCTGGTGACGTCGTTGTGCAATGGATTCCTCAATGCCTTTGTGAGCTACAAGGGCGCTAGTGAGTACACAGACCAGGACCAATTGT
TCGTGAACGGTATGGCGTTGCAGATTTCAGGCGCCGTGATCgcctttttcttcgtcgacaaACTGGATCACAAGTCTATTCTATTCGGTACCCTGATCCC
GATCGCGATTTGCGCCGGTGTGCTTGGCTTCAACGAAACGTCCGAGTTTTTAGCTGGCACAGAGGGCTCTGGCTTGTACGTCAGTCTCGTGGTCATGCTG
ATGTACTTCTTCATGGGTCTGGGTATCAGTTCGGCTCCGTGGGCGGCGTGCGTCGGAATGTTCACTACTCGTGGTCGTGCAGTATCGACGGTGATGCTTT
TCGGtctgttcttcttggccgaCCTGGGCTACGTGTACTTGCATACGCACGACTCACTAATGGCCAAGGAGTACATGTACCTGTACGCGCTCGCTGGTTT
CTGCGTTAttgcgctggtgctgattgTGGGCGCTGGCACCAAGAAGAATGGTATTATTTGCTCCAAGGCTGAAGCAGAACGTGATCGCGAACGCATGGCT
CGCCGCCGTGCCGATCGGGAAAGCCGTCGTGGACCTAATACTGCTCGCGGACGAAATCTCAGCCGTGTGCGGTCCAAATCCAATGCCCAGCGGGGCAACG
CGACTCCAGGAGCGTACCAGATGTACGAAACACCCGCGAACACCGCGCCTCCGCTTATG