Description :
From Genome Similarity Track
Location :
Scaffold_2150:1091- 2326
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2150-snap-gene-0.1Pectin lyase

Sequence
1235 bases(100 bases per row)
GAGAGCGCCGACACCAAAGTTGCCAGTCGCGCGGGCCAGTTTCTTCGCGGTGCCGGGCGTGTGCACCGCGACGCCCTTCATTTGCGCCATGGCATCGCTG
TCCTTGCGGCCGGTCAAAGCCCCAGAGCTCACGACCGTGTTCTCCACGCACTTGCGGCCGAGCGTGGACTGGCACAGGTTCTGGTTGCTCGCAGTGGGAA
CCATGATCGCGCCGGTCGTGGTCGAGTCCTGCAAGTTCGGGGTCGTCGTCTTCTCAAAGTAGTTGCCCTCGACGAGCACCCAGCCTTTGTCCGCGACGTC
GAACGAGAAGCCCGAGTTGTCGTACCAGTAGTTGTTCGCAGCGTGCGCGAGTACTTTGGTCGCAGTGTCCGACGAGCCACCGAACTTTGGCGAGCGACCC
GACGTGTGGTGTACGTAGTTGTTGATCATGTTGAGGCGCGTCTGGTGGCCGTGGAAGATGAACGTCCAGTAGTGGCGACCGTCGCACGACGCAGACCAGG
ACGTCTGGCCGTCAAACTCCGAGTTCGAAATCGTCAAGCTCTTGACGCTCGCGGCGTTCGTCGTGATCATCTGGCGACCAACGAGCGAGACCTTGATGTG
GTCGAACCACACGCGCTCCATGGTCGCGCCGCTGTCCGTGCCTTGGATGTAGATCGCATCACCACCCCAGATCAAGTGCGGGTTCAGATTCGTGATGTGG
ATGTTCTGGATGATCACATTGTTGCCCGCGATCCAGAGCCCCTTGCCGATGATCACACCAGAAGTACCTTCGCCGCGCAAGGTTTTGTTGTCGCGAACCT
TGATCGGGTTCTTCGTCCCAGCGACGTCGTAGGTCACGGTCACGGATGTGCCCTGGTCGCAGCCGCCCGTGTTCGCCATGCCGCCGCTCTGCAGGATCAC
ATCCTGGCCTTTGAAGCCGTTGTTCTTCGCGAGACAGTCGCGGTGTGACTTTGGACGGCACCCCGGTTCAGTCTTGGAGCCTTCGCTGCCACGGAAGTCG
AACGCCTTGTTCAGGATGACCACGCGCGGCTGGGCGTCCCCGAGGTACGATTTGAGTTCGGCAATGGTCTTTGGGTACACAGGCGCGGTGTTGCCGCCGC
CTGTCGTACCTGCCGCGAGACCTGGCGCGGTTCCGGTGCTGATAGCAGCAACAGAGTGGGCGAGGAGTGTGGTGACCACCGCCATGGTCACGACGCCGAT
GCGGAGGAAGAAACATTTCATCTCTCTTCTTTGGA