Description :
From Genome Similarity Track
Location :
contig_57:109096- 111010
Transcript NameFunction/comments
g10952.t1RAW36939.1 hypothetical protein PC110_g6783 [Phytophthora cactorum

Sequence
1914 bases(100 bases per row)
TCGACAGCATCCCACACTCCTCCGGCGTTAGGAGAAAATGAAGGCGACAACTCATGTCATTGTCTGTTTGCACCCTACCCGAGTTCAAAGTGCGAATGCA
AGTAGTGGAAGCAGTTAACATCAAATCTGGTCGTGGTGATAAATGCTCTGCCACCGTAAATCGCCTCCCATGCCGTTTCATATCGTGGCTCGGGGTGGAG
GTCGGCTCTCGTGAGGTAGTGTTGGCCGCGCTGACGATCAAGCTTCTCCTCTGGCCTTCGGCGGTGAGTGCAAGCATCAGAATGAGCACAGTGTCCTCGT
CGTTGCCATCGTAGATCATATTATAATGTAATAGATGCGGAACAGAGTGCTGCGGGTGGGCACGTACTTTTCTAAATCTGTGCGCACCAGCTAAACCTAT
GTTTTGGCGTCCCAGAATAACTGCGGGAATCACTCCAATGTTGACAGTTGTTTTCAAAATAATGGTCACTTTTGGGGCTTTAGCCGTACGTTTTACTAGT
ATTCTGCAAATTGATTGAGAGCCATCTGAAGCTGGTAGAGCGCTTGGGCTGCCGTTGGGCGAGCTGCCGGATCCCTTGATACGCATGCCATCCCGAGCTC
CACTATCACCATTGGACAGGAATCGGAAAATTCTACGTTCAGCTTGCCCTGCATCACGAGCCGCAGAACCGCCAAGTCGGACTTCGGACGACCCCTTTCT
GCGTTTCTTGCATACGGCAGCGCGTGCGAGTCGAGCTCCGAGAGAACCACACCGAAGGAAAATATATCGGCCTTCTCGTCGTACTTCTCCCCTGTCATCA
TCTCGGGCGCCATCCAGAGCGACGTGCCAACGCCAGCCGTCATCGTTTGATCAACTCGCGTGCGAGACACCCCAAAGTCGGTCAGCTTGGCATCAAGCTC
ATGCGTCAGCAAAATGTTCTTGGACTTGAGGTCGCGGTGCACGATCGGAGGTTCAAGCGAGTGCATATACGTGAGTGCATGTGCGACGTGCAGCGCGATC
TTCGCCTTGCTGGGGTCGAAACCAATCGGACGTCGCTCGTCCTGGTACCGATTCAAAAGCGCTCTCAGGTCTCCACCCCCCATGAACTCTGATACAACGC
ACAGGTCGGCGAACGAGTCCCAGGCCACGCCAATCAACTCGACGATGCGCGGGTGCTCCAGCGTCGCCATTAGCTTCACCTCCGCCAGGAATTCGTTCAC
ATTTTGGATCCGCTTGCGTGTCTCCGCCAACAGCATCTTGACAGCTACCTGCTGGCCGTTGAACGTTCCCACGTACACTTCGCCGTATCCTCCGCGAGAA
ATTCTTTCTTGCAGCAACACTTTCTCTCTTGGAATACGAGCCGCAACGATAACCTCGTCGTTCCAAAGACTGGCACCTTCACCCAACTTTCCTGTTTGCT
GGCTGGTTCCTGCTGTCATCAATTCCTCGTCGTAGTCGTTCTTGCTGCCTGATCGACTTGATCGTCTCCTCCAGACAAGCGTCGCTATCAAGCAGATGAC
AACGATACCCCCGACCACAATGGCAGCGATCACTCCCCCGCTAACCGACGAATTGGACGTGGAGCTGGTGTTCGTTGAGTTTGTGGAGGGCTCCGAGGTG
GAGGCTGCACTGGCGCTGTGTGACCCAGCCGCGACGATGACAAAATCTGAGCCGGTTGTGCTTGCGTTCGCGTCGCTGCTCATGCTGTTGTAGGTCTCCG
AGGCGGTCGTGTAGAACACGAGGCCGTACGAGCTGGAGTACCCGACAAGGCACGTCCACCCGACATCGGAGCTTGGAATGGACATATCGCTGACCGATTC
GGTGCATTCTGTGTCGTCGAACAACTGCAATTCCAGAGACAAATCTGCGTTTACAACCGCGATGGAGGCCGCATACGAAGTGATGTTGGGGAGAACTCTA
CACACTCCGTCAGC