Description :
From Genome Similarity Track
Location :
Scaffold_4:109082- 111431
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_19185Hypothetical protein
Sappa_CBS223.65SPRG_19186Hypothetical protein

Sequence
2349 bases(100 bases per row)
CCGATCGCCGAGCTCGGCCACGGCGAGTGCAACATGACGATGGTGTACAACCACAGCGCCAGGTCGGTCAAGGTGTCGCAGTCGACGTTCGTGGATGGAT
CGCTCCACGCTCTTGGGCTCATGTTTCCGCAGACGACCTTTAGCGCTGCGTCGTACTATCTCAAGTGCATTGCAGTGTTGTTTGCACTTGGTGGATACCT
CGCGAGCCGGCGCACGGTGCAGTGGCAGGACGTCGACGTGCATTCGACCGAGACCTTTGTGCAGCGCATCATGAAGACGGTCCTGCCCGAGTACTACCCA
CACGTCTCGCACGCCCTCCGCTTTGACATGTTTTGCTACAACTCGGACATTTTTGTGCTGCTGTTCACCATTGGCGTCCTCCTCGATCTGAGCGCGGCCT
TTATGTACTCGCGCGAAGTGCAAGTGTTTCTAGCCGTGTGCTCGAATGGCGCCTTGTCGCTGCAGCTCTTTGCTCTAAGTACGCGCCTGCTCTGGGTCAA
CTGCGGGTTTCTTAAGCTCTTCAAGCTTCTGTGGAGTATCTTGAGCACGGCAACGTACTCTGGCGAAAGCAAGCTCATGGGCTACCTCAATTTTACGGGT
GTCACATCGCTCTATTTGAGTGCAATTTTGCTCTTCTACATTCCGCCGTTCATCGAGTACAACAACACGTTGCGCATCGATCTCAAGAATTCGTTTGAAC
AGCTTGATGGGACACACGTCGACTTGTACAACAGCTTTTACGTGCGCAGCAGCGGCGCGATTGTCGGCGGTTTGATCTTGAACGTGCTTCTCGTTGTCGG
CCTCGATCAACTTGTGAACCAATCGTTTTGGAAACTTCTCGCGACCAACTCGCTCGCGCGCCAAGCCATGTACAACTCGACGTCGATCCTCATGGACTAT
GTCACTGACATTGATCCGACGATGCTGGAACAGCACTCGTCGAGCATCAACTGCAAGGTGCGCCGGCTCTGCACGCTCCAGTGGTTCTTTACGTCGCACC
TTACGGCGTTTGGCTTGCCCGAGAAGGAGCTCCGCGTCAACAAGAAGCAGGCGCACACCAAGAGCTTCATCTCGGCGGTCTCGGCGTTTGCAAGTGGTGG
CGAGGACGGCGCTGGTGACGGCACGTTCGTGCTTGCGCAGGACAGTGGCCGCCGTGTGCATCTCCTCGACGACCACTTTGCCGACGTCAAGAGCCTCGTC
CTCAACATCAAGATCCTCAAAAACACGTCCGTGTCGATTCGATAAGGCGCAATGCATTCAAACGCTAGGCTATTCATATTTGGGCCTCTGTCCCTGAGCA
ACAACGTCGCAGCGGGCATATCTGGTCGGCACCGAGGTCGTGTGCATCAGAACATTCGATCAAACTGACAACCTTGAGTGGGCTAGGGTTACGGCCGCGT
CAAGGGTCGCTCACCAACGTGGCCAGTGCGATGACGTACTGAGCGCCCGTCGCCAAGGAGCGAAGTCTCGGCGGGCGATGGCCGCGTCTGGGCACAGACA
AGAAGGTTTTTGTATACGACCAACAACGTCACGTAGAGTGTGCTGCTGGATTCCAACTGGGGGCAGTCGTCTCTGTGTTTGACAACGTCGTCTGCGGCGC
CAACATCCTTAACCCGTACACGTTCGGATAGCGTTTTAGAGACTAGATCGATTTCGAGCTCAATCTCTTGGTTTGGAATGAGAACTCGTGTCAACGAATT
GGTCACAAGGTCACTCTACGAATGAAATAGCTGCGTTGTTATCTCTATAGACGTATTGTACATATTGTATGCAACAAATGTAACATTATGGTTAGTAAAT
TGAGACGGCCGTGTTTTTGAGGATCTTGATGTTGATCACCAAGTTCTTCACATCACGAAGGTCGGCGTCGAGCAGGTGCACGTGTCGCCCGCTGTCCTGC
ACCACAAGGTACCGGTCGGCCGTCGGCTTCTCGGACTTTTCGGAAGCCGTCTCGGCTTGCGTGAGGAGCCCCGAGGCTTGCGTCGCGTTCTTGCTCGCAC
CACCTTGTGGTTGCAGTTTCTTGACGCGGAGCTCCTTCTCGGGCAGCCCAAATGTCGTCAAGTGGGACATGAGGAACCACTGGAGCGTGCAGAGTCGACG
CGCCTTGCAAAAGATGACGGCATTCGATTTCGACCGCTGCTCCAGGAGCTTCGGATCAATGTCAATGATGTAGTCCATGAGGATCGACGTCGAGTTGTAC
ATGGCTTGGCGCGCGAGCGAGTTGGTCGCGAGGAGTTTCCAGAACGACCGGTTCACAAGTTGATCGAGGCCGACGGCTAAAAGCACGTTGAGAAGCAAGC
CGCCGACAATTGCGCCGCTGCTGCGAATGTAGAAGCTTTCGTAATAGCT