Description :
From Genome Similarity Track
Location :
Scaffold_438:10907- 14140
Sequence
3233 bases(100 bases per row)
ATGGATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACGGCACAA
GTGGAAACGATTGCTAGATTGTTTTATAATACAGTATGGAGGTCAAGGTGTGTCAGTAGCCAGACAGTATTACCTCGCACGGAAGCGATCCGATGAAACC
CCGCTGGGGTACTTGCATCGTCTTAATGTCGCGGCCACGCATGCCAAGAACGCGATTAAAGAAGAAAGACTGGCTACATCGGCCACAAGTCGCGAGCATG
TGGAACACTTCATTGCTACGATGGACGATCGCGATCTGGCAAAACAGCTGACCTTACTGCTATTGATGGATATTGATGAGATGGAAGAAACTCTCCGTGC
GTGTCAACGGATGGAGAATCGTCAGATGAAATTGTCGATGGGATCAAACAAATTCCATCAGCGATCGGTCGCACCTGCAAATCCGATGGCGTCCAAGACA
ACTCGGGCGGTGCGAGCGATCCGCGAGAAAGTCGAGAGCAGCGGATCGGAATCGGAGTCGATTGGATCCGAGGAAGAACTGGATCGTCGTCGTGTTTGTG
TAACAACTACACCCGACCAAGAAAAACCGAACAAGGATCATCGCACCTGGCAGAAAAACACTGGTGAAGGGGAGGGACGCGATCGTAGTGGACGATCGAA
GGCGTGCACCCATTGTGGATCTACCAGACACGATGATCGAGGGTGCTGAAAGAGATTGACGTGCCAGAAATGTGGTCGCAAAGGAAACCCCTCTGACAAA
TGTTTCTTCGTTTGTGCAGCCTGCGGGGATATACACGAGAGTGGCAAGTGTTCCATGGAAGAATTTTTCAATTTGGTCCGAAAGTGGTACGTGTCTACGA
AGCATGCTGGAATGTTTCCGCCCAAGGTGGAGGAGATGTTAAACTAGAACGCTCGCCAGGTTGGAATATGGCACGAGCCGAGCGTTCTAGGCTTTGCCTT
TTTATGCATTTGTAGAAGGACCACGGAGAGATCAAGAGGTTAACGATCGGATCGATCCGATCGCTAACATACATAAAGATCTTACACTGGTCTCGTCAAT
ATCAAGTGTGAAAAGAGTGGATGATTACGCCCGATCTCCTGTGAGCATGGAGCTCGACCTCGCGCCAGGGGAATCGTGCGGGTATTGGAAATACCACACA
CCTGGAAAATGGTTTAAGCAAGCAAAAGCGGTG