Description :
From Genome Similarity Track
Location :
Scaffold_41:109065- 111272
Transcript NameFunction/comments
Hyaar_Emoy2805637hypothetical protein
Hyaar_Emoy2805638hypothetical protein
Hyaar_Emoy2805639hypothetical protein

Sequence
2207 bases(100 bases per row)
AGTGAGAAGAACGGTTCACATACGATGAACGGCTTCGTTTGCAGTAATAAGTTAGAGGCACAAAGATGGAGCTCTCCTGGCGACAGCATATCCGAGATTG
ACGAGAAGATGGACTGTACGGCATTCTCGGACTGCCATCATCATAACACGGTGAACAGCAACGAATGGGAACGTGATGGATTAGTCGTGGACCCTCATCG
CTCGTTGAGTCCGGGTGTCAACGGGTGCGATAAATTGTCCGAGTGGAAAGGAGGACTTTACCAGCGACTCGAGTCACGTGCGTGCAAATAATCCTGTAAC
GTCCGGTTGGCTCCTTTGCATTTTGGAATGGCGAAGGTCGGTACGACATTGGCTATACTGACCTAAAAAATGAATGATTGCGAGAAGGAAGGTGTGTGTG
ACCTCAGAGTTGACATCTCCATTGGAGCACAAGGTAAGAAAAGGATTGTTGTACACTAATGGAAGCAGAAAGAATGTGTTCTCGGATGGGAATGAAGAAC
CTGTTGACGCGAATCACCACGTCTTCGAACGGTGCCTCATCACATCATGGTCCGTCATGTTCATCATGTCCGAATCGTGACTCGTCCAGGGGTATCACGT
CCTTTGACAAGCTTCAGCCTCGTCACTTTCTGGCAACCTCAACTGCTGCTGCTGGACCTCCTCACAATTTTCGTGTGTCAGTAGTGTCCTGCAGCATTGT
AACTGGCAAATACTTCGTCCTTTGACGTCAGTTCTTATGGCAATTGCTCGTCCACTAATTCTCAGTCGATCGTCGTCGTCCCATAATCGTACCACCCACC
GCATCCAGATACTTCTCAATGCGTCGAGTGCTGACTTACTAGACGACTGAGGTCAATGTTCGTGTTTTTGACGAGCAGTTCGAGTAAGGCGGAAACGTCT
ATGAGACTAGAAACGGTGTGTATACATATATTCAAGCAATGTGAAAAACTAATGTGGAAATATCTATTGTAAGCCAACAACAACAAACGAAACAACCGTA
TGACGCTCTGCATCACATATCTAGATCTAAGTCGCGAAACCGCTTCAGTGCCATCAGGGAATGTATAGCTTCTTCTACATCATTCGGGTCAGAACCCGGC
TTGTCCGCGCCCAGCAGAGTCCTAAGGTCCTTCGACGGTTCCTTCTCCAAGGCATGTGAAAGATACTTCCTGGCAAGCGGGTGTTTTATAAGTTTTTTTA
CCACCTTAGCTGCTTCATTTTTAATAGCGGAGGTTCCGCCGTTCTTGACCTTGTCTTCGAGAAGGCGAGCCACAATGATAATCCTTATCTCCGTGTATGC
TTTGTCGTCCAAAGGTGTATCGTCAGTAATTCCCAGAGATTTCTTCGTGCGCGTCAGGCTCCACTTTGCTTCACCGCCTGCGCCAACCTGCCGCAGCAAT
GCAGCCCGGTTGAAAGCACCACGAGTATCGACCAGAAAATTGACCGCATCTTTTTCCCGACTGGGCTTTCCCGACATGCGTCGACTGTTCAATAAAGCAT
CGTTTAAATTCTCCGTTTCTTGCATGACTCGCCCAAACTTTTTTAGAGCGATAGGATTGTCGACGATTTTGTTCTGTCTGTCTTTGAAAAGTCTTTCCAC
AACGGGAGCATCAATGCCCTCAAGGTCGTCGAGCATCCGTCCCCGATATAGCAACGAGTAGAGGATGTCTGGATCAATAAGCGCGCGAGTTTTCTGGAAA
TCTTGTTCCCAGACACACTGAAACGGCGCCGCCGTCCAATCTTTCCTGCGGAAGTTTTTGGAATACTCCGTGACAAGCTTGGTGTATGGCTTAAGTAAAG
CATCTCAATCCATCGACAGCTCGAGTGCGTTCTTCGGCACCTTGATCATCTCCTTTATGGACTGCTGTCCTCGAGCCTACTGCGGGTTGACCAGATCCAG
TTCAGGTGCTATTTCTACGATGTGTTGCAGGGATTGAGGCTCAGCAACGAGCGCCTCAGGCATCTGATTTAGTTTGTTCGACATCGCTACGGTCTGCGGT
TGGAGTGCAGTTTTACTCCGCCGACACCCGATGGTAAATACCATCAAAATGTGTCCCGAGAAATGACCGCACGACGGCTAAATCTCTGTTCTCCTCCGTT
GACGCAAAGTCGTCGCTGTTGGACTCGCCGTCTGGCTTGTCCTCCTCTTGCTTTGGCACGCATAATGACCTCTTGCTGACGCGAGGGTCTGACTGGGTAC
TTTCGAC