Description :
From Genome Similarity Track
Location :
Scaffold_94:109058- 111155
Transcript NameFunction/comments
Physo_141110hypothetical protein

Sequence
2097 bases(100 bases per row)
TCAGCTAACGTTGAGCATCGCGGTGAGCTGCAAGTTGCCGCCCTGCGTCGACCGAGGAACCCACAAGAGCAACGAACCGCCTCCAGTTCCGGGGAGACCC
AGAAATCCAGGCCGCCACCGATCCAAGTACAGCGTCTTGCCTTCCAGCGCCGTCAAGTTCGATCTCCACGTCGCGACTTTGCCTGCACGCACGCTCACCT
CGTCGATCTTGTCGCCGCCAGACTTGATGTTCACGACCACGTCCTCGGTATCGACGCTCTTGAACGTGATGGTGACGGCGCCGTCGCCCACCCTCGTCCA
CATGCCGTGGCTGTTGTTGAACGCGCCTTGGACGATCTTCATGCCTAGCGCCTTCGTCGCGCTGCCGTCGTCGATCTCGCCGACGAGCTCCGTGGACGGA
CAGATGGGCTCGAAGAACTCGGACACGACCGAGGACATGTACCACCAGTCCCAAATGGCGTAGAACCCCATGGCTCTGTCCGCCACTTTGAACGCATACT
CTTTGGCCGTGAGGAACGTGCCGTTGCTGCTGGTTCCGGAGCTGATGAGGTCGTCTACGATGGCCGCGAACGTCTTGCGCAGCGTTCCGCGTCGGACGTA
GGCCTTAGCTTCATTGGACTCTGCGATCAGCTCGCTCATGCAGTTGTTGGTGGCGACGGGGATGTCGTGAAGCACGAGGTTCGATTGGCTCATGATCGCG
CGGATGTCGTCCTCAGAGATGCCTGGGTTCAGCCGACGCAGCTCTGCCACAGTCATCCACGTGCGGTCCAGCAGGCGCTTCATGTCGAAGCCGCAGGTCG
AGTTGGACTCGAGCGCAGTCTTCAAGTTGGTGATGTCCTTGTCGCTGAGCGAGTTGACTGTCTCGCCCATCGTGAGGTTCTTCATGAAGCCCGTGAACCG
TTCCCAGCTGGAGATGATGGCGTCGCCGTACGAGATGATTTCCCTCAGCGCGTACTCGGCCGTGGTGAGCACGCCGTCAGCGAGTTTGACGGTGTCGGAC
GCCTTCCCCCCCATGCAGTAGGAGATGGTCACTGGGATGTCGATGATGACGTTGTCGCTTTGATAGAGGATGGCGAGCAGCTTGTCTTCCGGGGTCTCTG
GGTTGTACACCTTGAGGTAGCGGATGTACTTGATGAGGGACTTGGTGAGGCTGAGGAGATACTTGGTGCACTTGACGGCGAGTTGAATGCCCTTGGCCCA
CTTAGACATGTCACCGTACATGTTCCATGAGGCGAGGGCGAGCGCGGTCTGCACCACCACGGCAGCCTTCCCCGCAATTGCGAGCGTACAGTCATCATTC
TGTCGGAGGCACTCGAATCCGCACTCGACAGGGTACAAGTATGGACACTGCATCCAGCACACGCCCAGCTTCTTGTCGAACCCCCACGGACACGTCTTGG
CGATGTGAGTCTTGCGCCAGCACGCGGAAGAGATGGACTGATCGAGCGCAGGGCCGACCCAGTTGGTGTACGTGGACTCGATGGTGCTGGTGGCGTTCAA
CACGCTGCCGAACTTGAGCGCAGCGCTCATGGATCCAAACACCACCTTGGATGCGGCTGCAGAGCCAGTGCTCGAGTCATCATCATCCACTGAGTCAACG
TCGCTCTCTTCGTCAGCGTCTTCGCCGTCGGAGTCGTCGTGATCCAGTTCTCGGGCCTCATCGTTGGCTGTTGGCAAGTAAGCTGGTGATTCGGTTTCTC
GTATAGTGGCTGTGGTGCTGGCGTTGTCAACGGTATCGGTTGTGTAGTTCATAGTAGGGGTCTTGGTAGTGTCTGACGCACCGTGGTCGGTGGAATAATT
GGCCGGAGCGACCGTAGCTAATGCGGCTGCATTGCGTCCGAACGAGTATACCTTCGCCGAGGTTGCTCCACTGAAGCTCGCTGCGAAGACAGTGAGCAGC
GCCGCTACTTTTGCCATCTTGGGTGCCGTTAGATGAAGTCGGGGAATAAAAAATGAAGTTGGCTGAGGCCATTTACTTGTCGCCGCCTTACTTACTGTAT
CGTACTGTACAACAGTTCACCATAACGACAATGCCCCTGACAAAGCCGTGGTGTCGCATCATCAAAACGCGTTGCTTCCAATCGTGAGTATTATTTT